Skip to main content
Download PDF

d-Limonene inhibits the occurrence and progression of LUAD through suppressing lipid droplet accumulation induced by PM2.5 exposure in vivo and in vitro

Respiratory Research volume 23, Article number: 338 (2022) Cite this article

Abstract

Background

PM2.5 exposure is associated with lung adenocarcinoma (LUAD), but the mechanism is unclear. The lack of understanding impedes our effort on prevention. This study examined a possible mechanism of lung cancer caused by PM2.5 exposure, and aimed to find a potential intervention for people living in PM2.5 polluted regions.

Methods

Electron microscopy and oil-red staining were conducted to examine the lipid droplet accumulation. Masson’s trichrome staining, colony forming, scratch assay and transwell experiment were conducted to evaluate the effect of PM2.5 exposure and d-limonene intervention on the occurrence and progression of LUAD. Potential intervention targets were found by RNA-Seq and verified by luciferase reporter assay. MiR-195 KO mice constructed with CRISPR/Cas9 technology were used to investigate the pivotal role of d-limonene-miR-195-SREBP1/FASN axis. Cohort analysis of lung cancer patients, human LUAD tissues staining and human intervention trial were also conducted to validate the results of cell and animal experiments.

Results

Our results showed that PM2.5 exposure induced accumulation of lipid droplets in LUAD cells which accompanied by increased malignant cellular behaviors. PM2.5 exposure led to cleaved N-SREBP1 translocation into nucleus, which activated the de novo lipogenesis pathway. Same changes were also observed in normal lung epithelial cells and normal lung tissue, and mice developed pulmonary fibrosis after long-term exposure to PM2.5. Furthermore, in a cohort of 11,712 lung cancer patients, significant lipid metabolism disorders were observed in higher PM2.5 polluted areas. In view of that, d-limonene was found to inhibit the changes in lipid metabolism through upregulating the expression of miR-195, which inhibited the expression of lipogenic genes (SREBF1/FASN/ACACA) specifically. And a small human intervention trial showed that serum miR-195 was upregulated after oral intake of d-limonene.

Conclusion

Our findings reveal a new mechanism of pulmonary fibrosis and LUAD that is related to PM2.5 exposure-induced lipid droplet accumulation. We also demonstrate that d-limonene-miR-195-SREBP1/FASN axis is a potential preventive intervention for mediating the progression and development of LUAD induced by PM2.5 exposure.

Trial registration Chinese Clinical Trial Registry, ChiCTR2000030200. Registered 25 February 2020, http://www.chictr.org.cn/showproj.aspx?proj=48013

Graphical Abstract

Introduction

Lung cancer is the second most common malignant tumor after breast cancer and the leading cause of cancer-related death worldwide [1]. Due to the reduction in tobacco smoking, the incidence of lung squamous cell carcinoma (LUSC) had decreased, while the incidence of lung adenocarcinoma (LUAD) has increased in never-smokers [2]. Aside from smoking, epidemiological data show that outdoor ambient air pollution, especially fine particulate matter (PM2.5) pollution, is another risk factor for lung cancer and has been classified as a level I carcinogen by the International Agency for Research on Cancer [3]. Because of the small particle size (aerodynamic equivalent diameter ≤ 2.5 μm) and large surface area in a given concentration, PM2.5 can easily invade the human alveolar and blood circulation and carry a variety of hazardous materials, such as carcinogens, promoting the occurrence of disease. A meta-analysis indicated that lung cancer risk increased 9% when the PM2.5 concentration increased by 10 µg/m3 [4]. Based on a prospective study in the UK biobank, long-term exposure to PM2.5 was associated with lower lung function and increased chronic obstructive pulmonary disease (COPD) prevalence, and may increase the risk of lung cancer, especially in those with high genetic risk [5, 6]. Study on a Chinses cohort of 118,551 participants also provide strong evidence that high PM2.5 exposure leads to an elevated risk of lung cancer incidence and mortality [7]. However, the potential mechanism of PM2.5 induced pulmonary injury still needs further understanding.

Oxidative stress, inflammation response, autophagy and mitochondria damage have been the focus of PM2.5 induced lung injury and cardiovascular disease [8,9,10,11]. Recently, integrated metabolomics and proteomics analysis of human bronchial epithelial cells exposed to PM2.5 reveal significant alterations of many metabolic processes, such as amino acid metabolism, citric acid cycle and lipid metabolism [12]. Lipid metabolism alternation is another prominent character of cancer in additional to carbohydrate metabolism, and enhanced synthesis or uptake of lipids contributes to rapid cancer cell growth and tumor formation [13, 14]. Most studies carried on the effects of PM2.5 exposure on lipid metabolism have focused on cardiovascular and liver related diseases, especially in atherosclerosis, non-alcoholic steatohepatitis (NASH), hepatic fibrosis and hepatocellular carcinoma [15,16,17,18]. Nevertheless, studies about pulmonary injury caused by PM2.5 exposure induced-lipid metabolism disorder are scarce.

In the present study, we integrated LUAD/human bronchial cells, wide type/knock out mice models and population intervention trial to comprehensively study the potential biological mechanism of PM2.5 exposure on the occurrence and progression of LUAD through the lipid metabolism disorder pathway. We identified de novo synthesis of lipids pathway that play critical roles in mediating pulmonary injury induced by PM2.5 exposure. And increased lipid droplet formation was observed in cancer and normal cells respectively, which we called them ‘Fatty Lung’. We also found that D-limonene could inhibit the occurrence and progression of LUAD through inhibiting the activity of lipogenic genes. Collectively, our study reveals a possible mechanism of lung injury caused by PM2.5 exposure and suggests a novel low-cost preventive intervention for people living in PM2.5 polluted regions.

Materials and methods

PM2.5 sample collection and preparation

The sampling site was located at Shanghai Jiao Tong University School of Medicine in Shanghai City, China. PM2.5 was sampled continuously using an Echo PM Low Volume Sampler near the air intake for the exposure chambers (MSP HFI-129, China). Every 3 days, a new filter was used for sampling. Additionally, field blanks were used to control for possible contamination during the sampling procedures. After sampling, the filters were cut into tiny pieces and placed in an ultrasonicator for 2 h. After filtration, PM2.5 solution was purified in a vacuum freeze drier for 7 days, and PM2.5 powder was stored in an ultracold storage freezer. Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Gas Chromatography Mass Spectrometer (GC–MS) and Carbon analyser were used to analysis the compositions of PM2.5 powder.

Cell culture and treatments

Human lung adenocarcinoma cell lines (A549, NCL-H1975) and immortalized human bronchial epithelial cell line (Beas-2b) were obtained from the American Type Culture Collection. Cells were kept in DMEM/high-glucose medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C in a 5% CO2 humidified culture incubator. According to our previous studies [19, 20], cells were exposed to PM2.5 or d-limonene for 48 h at a final concentration of 100 µg/mL or 0.25 mmol/L separately. Beas-2b cells were treated with the same concentration and maintained for 30 passages. Treated cells were then analysed in subsequent assays. All experiments were performed with mycoplasma-free cells.

siRNA transfection

Specific siRNAs (Jima Gene, China) were used for the knockdown of SREBF1 and FASN. A549 and H1975 cells were seeded in 6-well plate and transfected by the 1 µM SREBF1 or FASN siRNA via Lipofectamine 2000. After siRNA transfection for 24 h, the cells were stimulated with 100 µg/mL PM2.5 for 48 h. Finally, the expression of SREBF1 and FASN was confirmed by RT-qPCR.

Cell migration and cell invasion assays

A549 and H1975 cells were seeded into 6-well plates. After treatment, scratch wounds were made by scraping the cell layer in each culture well using the tip of a 200-µL pipette when the cell density reached > 90%. Then, the cells were washed with PBS and cultured for 24 h or more, individually or together, after which three fields were randomly chosen from each scratch wound and visualized by microscopy to evaluate the cell migration ability. The experiments were performed in triplicate.

Invasion assays were performed with Transwell inserts (8-µm pores, Millipore). The upper chambers of the Transwells were precoated with diluted Matrigel (BD Biosciences, Sparks, MD). A total of 104 cells were seeded onto the upper chamber in serum-free medium, and medium containing 10% serum was added to the lower chamber as a chemoattractant. After 24 h of incubation, the upper surface of the insert was wiped with a cotton swab, and cells that migrated to the lower surface were fixed with 4% paraformaldehyde (PFA) and stained with crystal violet. The cells were counted in three random fields per well, and the quantity is expressed as the mean ± SD of triple assessments.

Colony forming assay

Cells were exposed to the indicated treatments accordingly and seeded into 10 cm dishes (500 cells/dish). After culturing for 14 days, colonies were fixed with 4% PFA and stained with 0.4% crystal violet solution for analysis. Experiments were performed in triplicate.

RNA-Seq and data analysis

Cells were treated in triplicate per group with PM2.5, d-limonene or both. Total RNA was extracted and subsequently sequenced on an Illumina HiSeq 3000 machine. The RNA-Seq reads were aligned to the human genome (GRCh37/hg38) using TopHat version v2.1.0 with the hg38 iGenome annotation guide and default parameters. TopHat was also run permitting novel junctions for the purpose of novel transcript assembly. Cufflinks v2.2.1 was used to assemble transcript models and compare these to the reference hg38 iGenome annotation. Differentially expressed mRNAs were identified in cuffdiff 2.2.1 based on the criterion of being significantly altered in the experimental vs. control condition (P < 0.1 and absolute fold change > 1).

Electron microscopy

Cells and lung tissues were fixed with 1% osmic acid for 1 h. The samples were transferred into a penetrant prepared according to a ratio of embedding agent and acetone volume of 1:1. After using a 60-nm ultrathin microtome and staining in 1% uranyl acetate lead citrate for double staining, samples were observed and captured with an electron microscope.

Western blotting

After treatment, the cells and the mouse lung tissues were lysed by RIPA with protease phosphate inhibitor. The proteins were separated by 10% SDS-PAGE and electrotransferred to a Polyvinylidene Difluoride (PVDF) membrane. The PVDF membrane was blocked for 2 h at room temperature with 5% BCA and incubated overnight with rabbit or mouse polyclonal antibodies against GAPDH (CW0100M, CWBIO, China), ACTIN (CW0096, CWBIO, China), ACACA (ab45174, Abcam, UK), FASN (ab22759, Abcam, UK), SCAP (ab190103, Abcam, UK), Collage I (ab138492, Abcam, UK), Vimentin (ab92547, Abcam, UK) and SREBP1 (sc-365513, SCBT-Santa, Japan) at 4 °C. After washing with PBST for 0.5 h, the PVDF membrane was incubated for 2 h with antibody-conjugated goat anti-rabbit IgG or anti-mouse IgG. The PVDF membrane was washed with PBST and then visualized via a protein imaging system.

Luciferase reporter assay

Luciferase reporter plasmids containing the 3′ untranslated region (3′ UTR) of SREBP1—either the wild-type coding sequence region or a sequence with a mutation in the predicted binding site of the FASN and ACACA genes—were constructed by Jima Gene (China). A549 and H1975 cell lines were seeded in 12-well plates, and then the reporters (1 µg) and miR-195-mimics or negative control (NC) (25 nM) were co-transfected into the cells with Lipofectamine 2000. After 24 h, the cells were harvested, and luciferase activities were detected by the Dual Luciferase Reporter Assay Kit.

RT-qPCR analysis

Total RNA was extracted from cells and tissues after treatment using TRIzol. Subsequently, RNA was reverse-transcribed using PrimeScript™ RT Master Mix. RT-qPCR amplification was performed with an ABI 7500 system with PowerUP™ SYBR™ Green® Master Mix. The expression level of the target gene was normalized to that of GAPDH, and the 2−ΔΔCT method was used to calculate the expression results. Each group included 3 duplicate wells.

Masson’s trichrome staining

Mouse lung tissues embedded in wax were cut into 6-µm thick slices. The slices were immersed in dimethylbenzene and gradient ethanol for deparaffinization and rehydration. After staining in iron haematoxylin solution, 1% hydrochloric acid alcohol was used for differentiation. The slices were immersed in Ponceau staining solution, phosphomolybdate aqueous solution and aniline blue solution for 10 min, 3 and 6 min, respectively, for redyeing. The slices were sealed with Permount TM mounting medium after dehydration and vitrification in dimethylbenzene and gradient ethanol. Pictures were captured with a microscope, and data were analysed with Image Pro-Plus.

miR-195 knockout (KO) mice construction

We used CRISPR/Cas9 technology to construct a miR-195 KO mouse model via non-homologous recombination. The brief process is as follows: Cas9 mRNA and guide RNA (gRNA) (AAGACTCTACTTTGCTCTGT GGG) were obtained by in vitro transcription; Cas9 mRNA and gRNA were microinjected into the fertilized eggs of C57BL/6J mice to obtain F0 generation mice. After confirmation by PCR product sequencing, the obtained F0 generation mice with target gene deletion were mated with C57BL/6J mice to obtain positive F1 generation mice.

Animals and treatments

C57BL/6 male mice weighing 22–26 g were purchased from the Experimental Animal Center of Chinese Military Medical Sciences Academy. After 1 week of acclimatization, miR-195 KO and WT mice were randomly distributed into equal groups, including the control group, PM2.5 group and PM2.5 plus d-limonene group. The treatment groups were instilled into rear nasal cavities with a 0.1 mL PM2.5 suspension, while the control group was instilled with 0.1 mL physiological saline after the mice were anaesthetized with diethyl ether. d-Limonene was administered intragastric at a dose of 600 mg/kg body weight. Exposure was performed once every day, and this practice continued for 2 months. After every treatment, the mice were euthanized, and their lungs were rapidly removed. The mice were sacrificed by cervical dislocation. The removed lungs were placed in liquid nitrogen instantly.

Sample collection and oil red staining

Human LUAD cancer and corresponding adjacent noncancerous tissues were collected with informed consent from patients who underwent radical resections from Shanghai City and Hebei Province. The tissues were cut into 10-µm-thick slices after flash freezing in liquid nitrogen. The sections were fixed in ice-cold 4% PFA for 30 min and then placed into oil red solution for 10 min at 37 °C after washing in PBS. An 85% propylene glycol solution was used for 2 min for differentiation, and then the sections were rinsed in 2 changes of PBS.

Recruitment and inclusion/exclusion criteria

Twelve people were recruited into the d-limonene intervention group after strict inclusion and exclusion criteria were met (Trail number: ChiCTR2000030200), and 1 g d-limonene was administered every day for 4 weeks. Ten millilitres of whole blood was captured every 2 weeks, including at baseline. The inclusion criteria were as follows: healthy subjects more than 18 years old; body mass index (BMI) more than 18.5 kg/m3; no history of allergy to citrus fruits; and voluntarily participation with sign informed consent. The exclusion criteria were as follows: the presence of acute or chronic gastrointestinal diseases; intake of more than 50 g citrus fruits 1 day in a recent week; the presence of heart, liver, kidney or haematopoietic system disease or other serious diseases; severe allergic constitution; pregnant or lactating women; the use of anti-inflammatory drugs; surgery was not scheduled in the next 3 months.

Cohort analysis

We constructed a PM2.5 exposure cohort based on the SuValue database. The SuValue database included 221 hospitals from 23 provinces, municipalities or autonomous regions across China. The 221 hospitals included more than one million patients from 176 general hospitals, 28 traditional Chinese medicine hospitals, 14 maternal and childcare hospitals and 3 specialized hospitals. People in this cohort had at least two tests for triglycerides (TGs), which are the main component of lipid droplets. The PM2.5 dataset of each province across China was collected from the Atmospheric Composition Analysis Group.

Statistical analysis

The results of laboratory experiments are presented as the mean ± SD. Student’s t test was used to compare means between two groups, and ANOVA was employed for comparison of more than two groups when samples were normally distributed. Otherwise, the rank sum test was used for comparison between the two groups, and the Kruskal–Wallis test was used for comparison between multiple groups. All statistical analyses were performed using Statistical Package for the Social Sciences (SPSS) software (version 19.0) and GraphPad Prism version 8.0 (GraphPad Software, San Diego CA, USA). P < 0.05 indicates a significant difference (* means P < 0.05, ** means P < 0.01, *** means P < 0.001). All experiments were repeated three times.

Results

PM2.5 chemical characteristics

As shown in Table 1, the dominant components of metal ions and part non-metallic ions in PM2.5 were Al (1255.33 ± 5.51 ng/mg), Ca (9351.68 ± 69.97 ng/mg), Fe (2691.15 ± 20.84 ng/mg), Na (1567.68 ± 13.40 ng/mg), K (1567.43 ± 2.98 ng/mg), Mg (1074.41 ± 6.25 ng/mg) and S (12688.06 ± 66.99 ng/mg). The average concentrations of OC and EC in the PM2.5 were 527.11 ± 144.62 µg/mg and 119.71 ± 50.11 µg/mg, and the OC/EC ratio was about 4.61 ± 1.16. Among the total of 16 PAHs elements measured, Naphthalene, Acenaphthylene and Pyrene were the most abundant elements in the PM2.5.

Table 1 Metals, Carbon and organic compositions detected in PM2.5
Full size table

PM2.5 promotes the aggressive phenotypes of lung cancer cells and pulmonary fibrosis of mice

To study the toxic effect of PM2.5 on lung cancer, we treated A549 and H1975 LUAD cells with PM2.5. After treatment, cell migration assays showed that A549 and H1975 treated with PM2.5 migrated faster than those untreated cells, although A549 showed large variation in migration at 24 h (Fig. 1A). Colony formation assays showed increased colony formation in both A549 and H1975 after the cells were treated with PM2.5 for 14 days (Fig. 1B). Transwell assays demonstrated that A549 and H1975 cells treated with PM2.5 became more aggressive, and the number of cells penetrating through the Matrigel membrane increased by 2–4 times (Fig. 1C). Meanwhile, Masson’s trichrome staining showed that pulmonary fibrosis occurred in C57BL/6 mice obviously after long-term exposure to PM2.5 (Fig. 1D).

Fig. 1
figure 1

LUAD cells became more aggressive and WT mice got pulmonary fibrosis after PM2.5 exposure. A–C PM2.5 treatment increased the migration, colony formation and invasion of A549 and H1975 cells according to the wound healing assays, plate colony formation and Transwell experiments. D Masson’s trichrome staining showed that pulmonary fibrosis caused by PM2.5 exposure in C57BL/6 mice (N = 6). *P < 0.05; **P < 0.01; ***P < 0.001

Full size image

PM2.5 accumulates lipid droplets in LUAD cells after PM2.5 exposure

To understand the mechanisms by which PM2.5 promotes the aggressive phenotypes of lung cancer cells and pulmonary fibrosis of mice, we analyzed the transcriptomes of A549 cells with RNA-seq after PM2.5 treatment. The transcriptomic analysis revealed 263 differentially expressed genes (DEGs) between cells treated with and without PM2.5. Of these DEGs, 148 were upregulated, and 115 were downregulated (Fig. 2A). Using the Kyoto Encyclopedia of Genes and Genomes (KEGG) algorithm to interrogate the DEG profiles, we found significant signal enrichment in fatty acid metabolism (Fig. 2B). The top two genes involved were SREBFs (Fig. 2C). We confirmed these findings with RT-qPCR analysis on SREBF1 and its downstream targets, FASN and ACACA, all of which were upregulated significantly after PM2.5 treatment (Fig. 2D). Furthermore, we observed clear increases in lipid droplets in both cell lines evaluated with electron microscope or Oil Red O staining compared to those untreated cells after the treatment (Fig. 2E).

Fig. 2
figure 2

Transcriptomic analysis showed that lipogenic genes were upregulated and lipid droplets were clearly detected after PM2.5 treatment of A549 and H1975 cells. A Heat map showing the differentially expressed genes between A549 cells treated with and without PM2.5 exposure. B KEGG results showing enrichment of the DEGs in the lipid metabolism pathway. C Results of transcriptional regulatory relationships according to sentence-based text mining. D Verification of the target genes by RT-qPCR. SBEBF1, FASN and ACACA were upregulated after PM2.5 exposure. E Compared to the untreated cells (blank), lipid droplets were substantially increased in A549 and H1975 after the cells were treated with PM2.5, as shown by electron microscope (Scale bar = 500 nm) and oil red O staining (Scale bar = 50 μm). AP A549-blank group, AB A549-PM2.5 exposure group. ***P < 0.001

Full size image

PM2.5 promotes N-SREBP1 translocation into the nucleus, inducing lipid droplet formation and LUAD progression

Following the above findings, we speculate that PM2.5 may upregulate the expression of SREBP1 and its downstream genes, which leads to changes in lipid metabolism, resulting in increases in lipid droplets and aggressive cell behaviors. However, the level of total SREBP1 protein was not elevated obviously after PM2.5 exposure in either lung cancer cell lines based on western blot analysis, while its downstream proteins FASN and ACACA were clearly upregulated (Fig. 3a). Using fluorescence immunohistochemical staining for SREBP1, we found that the protein was enriched in the cell nucleus (Fig. 3B). Western blot analysis showed that N-SREBP1 and SREBP cleavage activating protein (SCAP) were upregulated after PM2.5 exposure (Fig. 3A). Next, we used siRNA to knock down SREBF1 and the main downstream gene FASN. Oil Red O staining showed that the number of intracellular lipid droplets in the knockdown cells after PM2.5 exposure was reduced (Fig. 3C). Additionally, knocking down the two genes inhibited the PM2.5-induced increases in cell invasion, migration and colony formation (Fig. 3D–F), suggesting that SREBP1 plays an important role in the accumulation of lipid droplets and the aggression of lung cancer cells induced by PM2.5 exposure.

Fig. 3
figure 3

PM2.5 promoted N-SREBP1 translocation into the nucleus, inducing lipid droplet formation. A Western blot analysis showed that N-SREBP1, FASN, ACACA and SCAP proteins were upregulated in H1975 and A549 cells after PM2.5 treatment. B Fluorescent staining showed that N-SREBP1 in the nucleus of A549 and H1975 cells was increased significantly after PM2.5 treatment. C Oil red O staining showed that the production of intracellular lipid droplets was reduced after SREBF1 or FASN was knocked down. D–F After SREBF1 or FASN was knocked down, the migration, colony formation and invasion abilities induced by PM2.5 treatment were inhibited. Scale bar = 50 μm. *P < 0.05; **P < 0.01

Full size image

d-Limonene inhibits PM2.5-induced lipid droplets accumulation in vivo and in vitro

To investigate whether d-limonene played a protective role in lipid metabolism disorder caused by PM2.5 exposure, cells and mice were treated with d-limonene when exposed to PM2.5 simultaneously. After treatment with d-limonene, lipid droplet formation induced by PM2.5 exposure was decreased dramatically in A549 and H1975 cells (Fig. 4A). Beas-2b cells were cultured under PM2.5 exposure for 30 passages. The PM2.5 treatment led to significant lipid droplets accumulation in the cells, and this phenomenon did not appear after the cells were treated with both PM2.5 and d-limonene (Fig. 4B). We also found a large amount of lipid droplets in the lung tissue of C57BL/6 mice after the animals were treated with PM2.5 for 60 days, but no lipid droplets were observed in the animals when d-limonene was orally administered simultaneously with PM2.5 inhalation (Fig. 4B). RNA-Seq analysis was performed on the lung tissues of mice treated with PM2.5 or PM2.5 plus d-limonene. The expression of Srebf1, Fasn and Acaca upregulated by PM2.5 exposure were suppressed by d-limonene treatment (Fig. 4C). Similar results were also seen in LUAD cells, and the findings were verified by RT-qPCR (Fig. 4D, E).

Fig. 4
figure 4

d-Limonene inhibited lipid droplets accumulation caused by PM2.5 exposure in vivo and in vitro. A Oil red O staining showed that PM2.5 exposure-induced lipid droplet formation was reduced after d-limonene treatment in LUAD cells. B Electron microscopic views of lipid droplets in normal lung epithelial cells (Beas-2b) and normal mouse lung tissue after long-term exposure to PM2.5. The number of lipid droplets decreased after treatment with d-limonene. C RNA-Seq analysis showed that PM2.5-induced upregulation of Srebf1, Fasn and Acaca was suppressed after treatment with d-limonene in mice. D, E PM2.5-induced upregulation of SREBF1, ACACA and FASN was inhibited by d-limonene intervention in A549 cell and C57BL/6 mice according to RT-qPCR. F Western blot analysis showed that PM2.5-induced upregulation of SREBF1, ACACA, and FASN was attenuated by treatment with D-limonene in Beas-2b cells and normal mouse lung tissue (N = 4, 5, 4). Scale bar = 500 nm. **P < 0.01; ***P < 0.001. CPM: C57BL/6 − PM2.5 exposure group; CPD: C57BL/6 − PM2.5 exposure + d-limonene group

Full size image

To assess time-dependent variations, we collected Beas-2b cell samples every 5 passages, and the samples were analysed with western blotting. As shown in Fig. 4f, the expression of SREBP1, FASN and ACACA were significantly higher in PM2.5-exposed than in control groups, and the increases appeared as early as in the fifth generation of cells. These proteins were also upregulated in the mouse lung tissue after a long period of exposure to PM2.5. Similar to the observations in LUAD cells, the expression of SREBP1, FASN and ACACA, which were promoted by PM2.5 exposure, were inhibited by d-limonene treatment to the mice (Fig. 4F).

d-Limonene inhibits PM2.5-induced the occurrence and progression of LUAD by upregulating miR-195

To investigate the protective mechanisms of d-limonene played in lung cancer, we analysed A549 and H1975 cells treated with or without d-limonene. Interestingly, we found that the expression of miR-195, a tumor suppressor, was substantially upregulated after d-limonene treatment (Fig. 5A). Using miRWalk [21] and miRSystem [22], we found that miR-195 was predicted to interact with SREBF1 in the CDS region when energy < − 20, accessibility < 0.0001, me < − 8. The in silico prediction also indicated that the miRNA could interact with FASN and ACACA mRNAs at their 3′ UTRs. The prediction that the seed sequence of miR-195 can directly bind to the CDS region of SREBF1 and the 3′ UTR of FASN and ACACA was verified by our dual luciferase assays. Our experiments showed that the relative luciferase activity was reduced in the WT groups compared with the mutant groups (Fig. 5B). After miR-195 was overexpressed in A549 cells, western blot analysis showed that SREBP1, FASN and ACACA were significantly inhibited (Fig. 5C).

Fig. 5
figure 5

d-Limonene inhibited lung cancer progression and pulmonary fibrosis by attenuating lipid metabolism disorder caused by PM2.5 exposure. A The expression of miR-195 increased after treatment with d-limonene. B Dual luciferase experiments showed the binding of miR-195 with SREBF1, FASN and ACACA mRNAs. C The protein expression of SREBP1, FASN and ACACA was inhibited by miR-195. D Western blot analysis showed that SREBP1, FASN and ACACA upregulated by PM2.5 exposure were attenuated by d-limonene or miR-195 treatment. E, F Plate colony formation and Transwell experiments showed that PM2.5-induced proliferation and invasion of lung cancer cells were inhibited by d-limonene or miR-195 treatment. G, H The upregulation of SREBF1, ACACA and FASN by PM2.5 in miR-195 KO mice was attenuated after d-limonene treatment (G), and the attenuation was more evident in WT mice (H). I Masson’s trichrome staining showed that d-limonene repaired the fibrosis caused by PM2.5 exposure, and the level of pulmonary fibrosis in miR-195 KO mice treated with d-limonene was significantly higher than that of WT mice (N = 6). J, K Western blot analysis showed that PM2.5-induced upregulation of collagen I and vimentin was inhibited by d-limonene in WT and miR-195 KO mice (N = 4, 5, 4, separately). *P < 0.05; **P < 0.01; ***P < 0.001. MPM: miR-195 KO mice − PM2.5 exposure group. MPD: miR-195 KO mice − PM2.5 exposure + d-limonene group. CPD: C57BL/6J mice − PM2.5 exposure + d-limonene group

Full size image

To verify the effects of d-limonene and miR-195 on inhibiting lipid metabolism disorder caused by PM2.5 exposure, A549 and H1975 cells were treated with or without miR-195 or d-limonene after PM2.5 exposure. Western blot analysis showed that d-limonene or miR-195 decreased the protein levels of SREBP1, FASN and ACACA, which were upregulated in A549 and H1975 cells after PM2.5 exposure (Fig. 5D). Colony formation and Transwell experiments showed that both d-limonene and miR-195 inhibited the PM2.5 exposure-induced proliferation and invasion of lung cancer cells (Fig. 5E, F). The RNA-Seq results of miR-195 KO treated with PM2.5 with or without d-limonene showed that d-limonene inhibited the increases in expression of Srebf1, Fasn and Acaca induced by PM2.5 exposure in the KO mice (Fig. 5G), but the inhibitory effect was weaker than that in the WT mice (Fig. 5H). Furthermore, Masson’s trichrome staining and western blotting analysis revealed that pulmonary fibrosis occurred in both WT mice and miR-195 KO mice after long-term exposure to PM2.5. This phenotype could be rescued by d-limonene treatment. The level of pulmonary fibrosis in miR-195 KO mice treated with d-limonene was significantly higher than that in WT mice (Fig. 5I–K). The above results suggest that the presence of miR-195 in WT mice facilitates the d-limonene’s suppression and attenuation on PM2.5-induced lipid-related gene expression and of pulmonary fibrosis development, respectively.

PM2.5 exposure increased TG levels in human plasma and lipid droplets in the lung tissue of cancer patients

We assembled a cohort of 11,712 lung cancer patients with information on serum TG levels and their residences where air monitoring data were available on ambient PM2.5. Based on their residence, 7663 individuals were classified as living in high exposure areas, and 4049 were in low exposure regions. More patients living in high exposure regions had higher TG levels than those living low exposure regions, 60% vs. 52% (Fig. 6A). Multivariate logistic regression analysis showed that high PM2.5 exposure were associated with elevated serum TG levels after adjusting for sex and age (HR = 1.39, 95% CI 1.29–1.50) (Fig. 6B). Compared to those in Shanghai City, lung cancer patients from Hebei Province where PM2.5 pollution was higher than Shanghai, had more lipid droplets in their lung tissues according to the Oil Red O staining (Fig. 6C, D). A single-arm d-limonene intervention trial was conducted in twelve people. Over a 4-week oral administration of d-limonene, individuals in the trial had substantial increases in serum levels of miR-195 (Fig. 6E).

Fig. 6
figure 6

Serum levels of TG and tissue levels of lipid droplets in people living in regions with different PM2.5 pollution. A 60% of people living in regions with high PM2.5 pollution had higher serum levels of TG, whereas 52% of people living in low pollution areas had the same levels of TG. B Multivariate logistic regression analysis showed that PM2.5 exposure were associated with high TG levels. C, D Oil red O staining results showed more lipid droplets in the lung tissue of cancer patients living in high than in low PM2.5 pollution areas (N = 5). *P < 0.05. E Changes in miR-195 levels in people taking d-limonene orally (N = 12). SH Shanghai City, HB Hebei Province

Full size image

Discussion

PM2.5 exposure is an important environmental risk factor for pulmonary injury and lung cancer mortality [23,24,25,26], but the mechanism is unclear. The lack of understanding impedes our effort on prevention. In our previous studies, we found that PM2.5 influenced lung cancer cells by increasing oxidative stress and autophagy and dysregulating certain long non-coding RNAs (lncRNAs) [19, 20]. Other researchers reported that PM2.5 upregulated Wnt3a/β‑catenin pathway and IL-17a signal pathway or reduced the levels of 15-lipoxygenases, which influenced the progression of lung cancer [27,28,29]. In this study, we found a notable phenomenon that long-term environmental exposure to ambient PM2.5 leads to enlarged lipid droplet accumulation in pulmonary cells and then identified a possible mechanism that may explain the phenomenon. We found that PM2.5-induced lipid droplet accumulation was caused by the translocation of SREBP1 from cytoplasm to nucleus where it upregulated the expression of FASN and ACACA and activated de novo lipogenesis pathway resulting in dysregulation of lipid metabolism.

Lipid droplets are metabolically active organelles with a neutral lipid core (predominantly triglycerides and cholesterol esters) surrounded by a monolayer of phospholipids and proteins [30]. More recently, they are well known as critical organelles involved in numerous biological functions, especially in the field of liver-related diseases [31]. Lipid droplets in more than 5% of the hepatocytes is a significant characteristic of Non-alcoholic fatty liver disease (NAFLD), which can be followed by the development of hepatic fibrosis, liver cirrhosis and even hepatocellular carcinoma [32, 33]. Lipid droplet have been reported to be involved in several types of cancer [34, 35], including pancreatic ductal adenocarcinoma [36], colorectal cancer [37], breast cancer [38], and ovarian cancer [39]. Zhou and Huang et al. found that lipid droplets accumulated in lung cancer cells could induce EGFR-TKI resistance, which would be overcame by co-administration of lipid metabolism inhibitors and EGFR-TKIs [40, 41].

We found that lipid droplets became increasingly larger in lung cancer cells after exposure to PM2.5 (Fig. 2E). Lipid droplets also appeared in normal lung epithelial cells and mouse lung tissues after PM2.5 exposure (Fig. 4B). They were all accompanied by increased malignant cellular behaviors or fibrosis (Fig. 5I). Our patient cohort also showed that circulating levels of TG were higher in people living in PM2.5 heavily polluted regions than in those living in low polluted areas (Fig. 6A). It is similar to the data from cohort studies in Chinese rural population and Korean soldiers, PM2.5 exposure are associated with higher blood TG levels [42,43,44]. Analysis of tumor specimens from lung cancer patients living in Hebei Province, where there is heavy ambient PM2.5 pollution due to the presence of many iron and steel mills, showed more lipid droplets in their tissue samples compared to those living in Shanghai, confirming that PM2.5 exposure may disrupt lipid metabolism and induce lipid droplet accumulation in human lung tissues.

Lipid droplet accumulation induced by de novo lipogenesis is an important component of lipid metabolism reprogramming, which is widely involved in the development of cancers [45, 46]. SREBP-1 is a key molecule in regulating the production of fatty acids and triglycerides through stimulating the expression of FASN and ACACA, which increases cancer cell viability and promotes tumor growth [47]. Inhibition of de novo fatty acid synthesis suppresses tumor growth of non-small-cell lung cancer in preclinical model [48]. In comparison of cell transcriptomes with and without PM2.5 treatment, we found that de novo lipogenesis-related genes, including SBEBF1, FASN and ACACA, were differentially expressed as part of the top signature upregulated by PM2.5 (Fig. 2). Our follow-up experiments showed that PM2.5 exposure led to the nuclear entry of N-SREBP1 which upregulated FASN and ACACA. Interestingly, the protein expression of SREBP1 increased in normal cells when exposed to PM2.5 from P5 to P30 (Fig. 4F), which was a little higher than that occurred in cancer cells (Fig. 3A). The deterioration of cancer cells urgently needs more energy and material support. Therefore, when exposed to PM2.5, more SREBP1 was cleaved and transported into the nucleus rapidly to promote the generation of triglycerides and lipid droplets, which promoted the invasion, migration and proliferation of cancer cells. Since the resistance of normal cells and deterioration required an accumulation process, SREBF1 upregulated after PM2.5 exposure, and the protein expression level of SREBP1 was even a little higher than that of cancer cells. In vitro experiments demonstrated that lipid droplets were decreased, and cell invasion, migration and proliferation were inhibited when we used siRNA to knock down the expression of SREBF1 or FASN. These observations suggest that dysregulated lipid metabolism induced lipid droplets accumulation after PM2.5 exposure may play an important role in the occurrence and progression of lung cancer and that blocking or correcting lipid metabolism dysregulation may be a potential intervention strategy for reducing lung cancer risk associated with PM2.5 exposure.

d-Limonene has been found to regulate lipid metabolism in hepatic cells [49]. Morse et al. found that d-limonene could inhibit the metabolic activation of nitrosamine and thus prevent the development of NNK-induced lung cancer through its interaction with cytochrome P450 detoxification enzymes [50]. We reported previously that d-limonene exerts its antitumor activity by inducing autophagy and apoptosis and by regulating lipid metabolism in cancer cells [51,52,53]. In this study, we further demonstrated that d-limonene inhibited the expression of SBEBF1, FASN and ACACA and decreased lipid droplet accumulation in LUAD cells. d-Limonene could also suppress the colony formation, proliferation, invasion, and migration of lung cancer cells. These results suggest that d-limonene may target the genes affected by PM2.5 and regulate the synthesis and metabolism of lipid droplets.

Furthermore, we found that the expression of miR-195 was increased significantly when the A549 and H1975 cell lines were treated with d-limonene. This miRNA reported by us and others before can suppress the growth of lung cancer and other cancers, including acute lymphoblastic leukaemia, triple-negative breast, liver, glioblastoma, prostate, stomach and colorectal cancers [54,55,56,57,58,59]. We also found that miR-195 could directly bind to the mRNAs of SREBF1, FASN and ACACA in lung cancer cells resulting in decreases in lipid droplet formation induced by PM2.5 exposure. In addition to inhibiting cancer cell growth, migration and invasion induced by PM2.5 exposure, d-limonene may also prevent or slower the development of lung cancer. Our study showed that d-limonene treatment could block or slow the formation of pulmonary fibrosis caused by long-term PM2.5 exposure both in vivo and in vitro.

To understand the significance of miR-195 in d-limonene intervention, a miR-195 KO mouse model was established. As shown in Fig. 5, when miR-195 was knocked out, the effect of d-limonene became weaker, and more fibrosis was indicated by high collagen fibre staining and collagen I expression in the animals compared to the wide type mice. Li et al. found that miR-195 may serve as a biomarker to assist the diagnosis of lung cancer and classification of high-risk populations [60]. In our small trial, we found that the expression of miR-195 was dramatically increased in human serum after d-limonene treatment, which suggests that miR-195 may serve as a potential biomarker for monitoring the effect of d-limonene administration.

Conclusion

In summary, our study showed that PM2.5 exposure caused accumulation of lipid droplets in lung cancer cells, normal lung epithelial cells and normal pulmonary tissue, which promoted pulmonary fibrosis and progression of lung adenocarcinoma. This phenomenon resulted from PM2.5-induced dysregulation of several proteins (SREBP1, FASN and ACACA) which control de novo lipogenesis. Our study also showed that a monoterpenoid D-limonene could block or reduce the disruption of lipid metabolism caused by PM2.5 exposure, indicating its potential value as a chemopreventive agent for reducing the risk of lung cancer associated with PM2.5 exposure. Finally, we found that miR-195 could mediate the effect of d-limonene on lipid metabolism, suggesting that the miRNA may serve as a biomarker to monitor the use of d-limonene.

Availability of data and materials

The datasets generated/analysed in the present study are available upon reasonable request from the corresponding author.

Abbreviations

3′ UTR:

3′ Untranslated region

ACACA:

Acetyl-CoA carboxylase

BMI:

Body mass index

COPD:

Chronic obstructive pulmonary disease

DEGs:

Differentially expressed genes

FASN:

Fatty acid synthase

gRNA:

Guide RNA

KEGG:

Kyoto Encyclopedia of Genes and Genomes

KO:

Knock out

LUAD:

Lung adenocarcinoma

LUSC:

Lung squamous cell carcinoma

NASH:

Non-alcoholic steatohepatitis

PM2.5 :

Fine particulate matter

SREBP1:

Sterol regulatory element-binding protein-1

TG:

Triglyceride

References

  1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49.

    Article  Google Scholar 

  2. Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer. Nature. 2018;553:446–54.

    Article  CAS  Google Scholar 

  3. International Agency for Research on Cancer. Outdoor Air pollution a leading environmental cause of cancer deaths, air quality & climate change; 2013. p. 109.

  4. Chen J, Hoek G. Long-term exposure to PM and all-cause and cause-specific mortality: a systematic review and meta-analysis. Environ Int. 2020;143:105974.

    Article  CAS  Google Scholar 

  5. Huang Y, Zhu M, Ji M, Fan J, Xie J, Wei X, et al. Air pollution, genetic factors, and the risk of lung cancer: a prospective study in the UK Biobank. Am J Respir Crit Care Med. 2021;204:817–25.

    Article  CAS  Google Scholar 

  6. Doiron D, de Hoogh K, Probst-Hensch N, Fortier I, Cai Y, De Matteis S, et al. Air pollution, lung function and COPD: results from the population-based UK Biobank study. Eur Respir J. 2019;54:1802140.

    Article  CAS  Google Scholar 

  7. Li J, Lu X, Liu F, Liang F, Huang K, Yang X, et al. Chronic effects of high fine particulate matter exposure on lung cancer in China. Am J Respir Crit Care Med. 2020;202:1551–9.

    Article  CAS  Google Scholar 

  8. Xu X, Wang H, Liu S, Xing C, Liu Y, Aodengqimuge, Zhou W, et al. TP53-dependent autophagy links the ATR-CHEK1 axis activation to proinflammatory VEGFA production in human bronchial epithelial cells exposed to fine particulate matter (PM2.5). Autophagy. 2016;12:1832–48.

    Article  CAS  Google Scholar 

  9. Yue W, Tong L, Liu X, Weng X, Chen X, Wang D, et al. Short term PM2.5 exposure caused a robust lung inflammation, vascular remodeling, and exacerbated transition from left ventricular failure to right ventricular hypertrophy. Redox Biol. 2019;22:101161.

    Article  CAS  Google Scholar 

  10. Luo F, Guo H, Yu H, Li Y, Feng Y, Wang Y. PM2.5 organic extract mediates inflammation through the ERβ pathway to contribute to lung carcinogenesis in vitro and vivo. Chemosphere. 2021;263:127867.

    Article  CAS  Google Scholar 

  11. Liu X, Zhao X, Li X, Lv S, Ma R, Qi Y, et al. PM2.5 triggered apoptosis in lung epithelial cells through the mitochondrial apoptotic way mediated by a ROS-DRP1-mitochondrial fission axis. J Hazard Mater. 2020;397:122608.

    Article  CAS  Google Scholar 

  12. Song X, Liu J, Geng N, Shan Y, Zhang B, Zhao B, et al. Multi-omics analysis to reveal disorders of cell metabolism and integrin signaling pathways induced by PM2.5. J Hazard Mater. 2020;424:127573.

    Article  Google Scholar 

  13. Snaebjornsson MT, Janaki-Raman S, Schulze A. Greasing the wheels of the cancer machine: the role of lipid metabolism in cancer. Cell Metab. 2020;31:62–76.

    Article  CAS  Google Scholar 

  14. Luo X, Cheng C, Tan Z, Li N, Tang M, Yang L, Cao Y. Emerging roles of lipid metabolism in cancer metastasis. Mol Cancer. 2017;16:76.

    Article  Google Scholar 

  15. Sun Q, Wang A, Jin X, Natanzon A, Duquaine D, Brook RD, et al. Long-term air pollution exposure and acceleration of atherosclerosis and vascular inflammation in an animal model. JAMA. 2005;294:3003–10.

    Article  CAS  Google Scholar 

  16. Xu MX, Ge CX, Qin YT, Gu TT, Lou DS, Li Q, et al. Prolonged PM2.5 exposure elevates risk of oxidative stress-driven nonalcoholic fatty liver disease by triggering increase of dyslipidemia. Free Radic Biol Med. 2019;130:542–56.

    Article  CAS  Google Scholar 

  17. Ding D, Ye G, Lin Y, Lu Y, Zhang H, Zhang X, et al. MicroRNA-26a-CD36 signaling pathway: pivotal role in lipid accumulation in hepatocytes induced by PM2.5 liposoluble extracts. Environ Pollut. 2019;248:269–78.

    Article  CAS  Google Scholar 

  18. Li R, Sun Q, Lam SM, Chen R, Zhu J, Gu W, et al. Sex-dependent effects of ambient PM2.5 pollution on insulin sensitivity and hepatic lipid metabolism in mice. Part Fibre Toxicol. 2020;17:14.

    Article  CAS  Google Scholar 

  19. Deng X, Zhang F, Rui W, Long F, Wang L, Feng Z, et al. PM2.5-induced oxidative stress triggers autophagy in human lung epithelial A549 cells. Toxicol In Vitro. 2013;27:1762–70.

    Article  CAS  Google Scholar 

  20. Deng X, Feng N, Zheng M, Ye X, Lin H, Yu X, et al. PM2.5 exposure-induced autophagy is mediated by lncRNA loc146880 which also promotes the migration and invasion of lung cancer cells. Biochim Biophys Acta (BBA) Gen Subj. 2017;1861:112–25.

    Article  CAS  Google Scholar 

  21. Sticht C, De La Torre C, Parveen A, Gretz N. miRWalk: an online resource for prediction of microRNA binding sites. PLoS ONE. 2018;13:e0206239.

    Article  Google Scholar 

  22. Lu TP, Lee CY, Tsai MH, Chiu YC, Hsiao CK, Lai LC, et al. miRSystem: an integrated system for characterizing enriched functions and pathways of microRNA targets. PLoS ONE. 2012;7:e42390.

    Article  CAS  Google Scholar 

  23. Pope CA, Burnett RT, Thun MJ, Calle EE, Krewski D, Ito K, et al. Lung cancer, cardiopulmonary mortality, and long-term exposure to fine particulate air pollution. JAMA. 2002;287:1132–41.

    Article  CAS  Google Scholar 

  24. Turner MC, Krewski D, Pope CA, Chen Y, Gapstur SM, Thun MJ. Long-term ambient fine particulate matter air pollution and lung cancer in a large cohort of never-smokers. Am J Respir Crit Care Med. 2011;184:1374–81.

    Article  Google Scholar 

  25. Turner MC, Andersen ZJ, Baccarelli A, Diver WR, Gapstur SM, Pope CA, et al. Outdoor air pollution and cancer: an overview of the current evidence and public health recommendations. CA Cancer J Clin. 2020;70:21632.

    Article  Google Scholar 

  26. Chen S, Chen L, Ye L, Jiang Y, Li Q, Zhang H, et al. PP2A-mTOR-p70S6K/4E-BP1 axis regulates M1 polarization of pulmonary macrophages and promotes ambient particulate matter induced mouse lung injury. J Hazard Mater. 2022;424:127624.

    Article  CAS  Google Scholar 

  27. Xu H, Jiao X, Wu Y, Li S, Cao L, Dong L. Exosomes derived from PM2.5-treated lung cancer cells promote the growth of lung cancer via the Wnt3a/β–catenin pathway. Oncol Rep. 2019;41:1180–8.

    CAS  Google Scholar 

  28. Li MY, Liu LZ, Li W, Ng CSH, Liu Y, Kong AWY, et al. Ambient fine particulate matter inhibits 15-lipoxygenases to promote lung carcinogenesis. J Exp Clin Cancer Res. 2019;38:359.

    Article  Google Scholar 

  29. Chao X, Yi L, Lan LL, Wei HY, Wei D. Long-term PM2.5 exposure increases the risk of non-small cell lung cancer (NSCLC) progression by enhancing interleukin-17a (IL-17a)-regulated proliferation and metastasis. Aging. 2020;12:11579–602.

    Article  CAS  Google Scholar 

  30. Farese RV, Walther TC. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 2009;139:855–60.

    Article  CAS  Google Scholar 

  31. Olzmann JA, Carvalho P. Dynamics and functions of lipid droplets. Nat Rev Mol Cell Biol. 2019;20:137–55.

    Article  CAS  Google Scholar 

  32. Scorletti E, Carr RM. A new perspective on NAFLD: focusing on lipid droplets. J Hepatol. 2022;76:934–45.

    Article  CAS  Google Scholar 

  33. Gluchowski NL, Becuwe M, Walther TC, Farese RV. Lipid droplets and liver disease: from basic biology to clinical implications. Nat Rev Gastroenterol Hepatol. 2017;14:343–55.

    Article  CAS  Google Scholar 

  34. Tirinato L, Pagliari F, Limongi T, Marini M, Falqui A, Seco J, et al. An overview of lipid droplets in cancer and cancer stem cells. Stem Cells Int. 2017. https://doi.org/10.1155/2017/1656053.

    Article  Google Scholar 

  35. Chowdhury R, Amin MA, Bhattacharyya K. Intermittent fluorescence oscillations in lipid droplets in a live normal and lung cancer cell: time-resolved confocal microscopy. J Phys Chem B. 2015;119:10868–75.

    Article  CAS  Google Scholar 

  36. Sunami Y, Rebelo A, Kleeff J. Lipid metabolism and lipid droplets in pancreatic cancer and stellate cells. Cancers. 2018;10:3.

    Article  Google Scholar 

  37. Tirinato L, Liberale C, Di Franco S, Candeloro P, Benfante A, La R, Rocca, et al. Lipid droplets: a new player in colorectal cancer stem cells unveiled by spectroscopic imaging. Stem Cells. 2015;33:35–44.

    Article  CAS  Google Scholar 

  38. Jarc E, Kump A, Malavašič P, Eichmann TO, Zimmermann R, Petan T. Lipid droplets induced by secreted phospholipase A2 and unsaturated fatty acids protect breast cancer cells from nutrient and lipotoxic stress. Biochim Biophys Acta (BBA) Mol Cell Biol Lipids. 2018;1863:247–65.

    CAS  Google Scholar 

  39. Li J, Condello S, Thomes-Pepin J, Ma X, Xia Y, Hurley TD, et al. Lipid desaturation is a metabolic marker and therapeutic target of ovarian cancer stem cells. Cell Stem Cell. 2017;20:303–14.

    Article  CAS  Google Scholar 

  40. Huang Q, Wang Q, Li D, Wei X, Jia Y, Zhang Z, et al. Co-administration of 20(S)-protopanaxatriol (g-PPT) and EGFR-TKI overcomes EGFR-TKI resistance by decreasing SCD1 induced lipid accumulation in non-small cell lung cancer. J Exp Clin Cancer Res. 2019;38:129.

    Article  Google Scholar 

  41. Zhou W, Zhang J, Yan M, Wu J, Lian S, Sun K, et al. Orlistat induces ferroptosis-like cell death of lung cancer cells. Front Med. 2021;15:922–32.

    Article  Google Scholar 

  42. Mao S, Chen G, Liu F, Li N, Wang C, Liu Y, et al. Long-term effects of ambient air pollutants to blood lipids and dyslipidemias in a Chinese rural population. Environ Pollut. 2020;256:113403.

    Article  CAS  Google Scholar 

  43. Kim KN, Ha B, Seog W, Hwang IU. Long-term exposure to air pollution and the blood lipid levels of healthy young men. Environ Int. 2022;161:107119.

    Article  CAS  Google Scholar 

  44. Woo KS, Chook P, Hu YJ, Lao XQ, Lin CQ, Lee P, et al. The impact of particulate matter air pollution (PM2.5) on atherosclerosis in modernizing China: a report from the CATHAY study. Int J Epidemiol. 2021;50:578–88.

    Article  CAS  Google Scholar 

  45. Liu L, Zhao X, Zhao L, Li J, Yang H, Zhu Z, et al. Arginine methylation of SREBP1a via PRMT5 promotes de novo lipogenesis and tumor growth. Cancer Res. 2016;76:1260–72.

    Article  CAS  Google Scholar 

  46. Flaveny CA, Griffett K, El-Gendy Bel D, Kazantzis M, Sengupta M, Amelio AL, et al. Broad anti-tumor activity of a small molecule that selectively targets the Warburg effect and lipogenesis. Cancer Cell. 2015;28:42–56.

    Article  CAS  Google Scholar 

  47. Lewis CA, Brault C, Peck B, Bensaad K, Griffiths B, Mitter R, et al. SREBP maintains lipid biosynthesis and viability of cancer cells under lipid- and oxygen-deprived conditions and defines a gene signature associated with poor survival in glioblastoma multiforme. Oncogene. 2015;34:5128–40.

    Article  CAS  Google Scholar 

  48. Svensson RU, Parker SJ, Eichner LJ, Kolar MJ, Wallace M, Brun SN, et al. Inhibition of acetyl-CoA carboxylase suppresses fatty acid synthesis and tumor growth of non-small-cell lung cancer in preclinical models. Nat Med. 2016;22:1108–19.

    Article  CAS  Google Scholar 

  49. Castro MA, Llanos MA, Rodenak-Kladniew BE, Gavernet L, Galle ME, Crespo R. Citrus reticulata peel oil as an antiatherogenic agent: hypolipogenic effect in hepatic cells, lipid storage decrease in foam cells, and prevention of LDL oxidation. Nutr Metab Cardiovasc Dis. 2020;9:1590–9.

    Article  Google Scholar 

  50. Morse MA, Toburen AL. Inhibition of metabolic activation of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone by limonene. Cancer Lett. 1996;104:211–7.

    Article  CAS  Google Scholar 

  51. Yu X, Lin H, Wang Y, Lv W, Zhang S, Qian Y, et al. d-Limonene exhibits antitumor activity by inducing autophagy and apoptosis in lung cancer. OncoTargets Ther. 2018;11:1833.

    Article  Google Scholar 

  52. Feng T, Zhang Q, Li Q, Zhu T, Lv W, Yu H, et al. LUAD transcriptomic profile analysis of d-limonene and potential lncRNA chemopreventive target. Food Funct. 2020;11:7255–65.

    Article  CAS  Google Scholar 

  53. Zhu T, Li Q, Xu L, Zhang Q, Lv W, Yu H, et al. Stratification of lung adenocarcinoma patients for d-limonene intervention based on the expression signature genes. Food Funct. 2021;12:7214–26.

    Article  CAS  Google Scholar 

  54. Zhang W, Wang Y, Zhu Z, Zheng Y, Song B. Propofol inhibits proliferation, migration and invasion of gastric cancer cells by up-regulating microRNA-195. Int J Biol Macromol. 2018;120:975–84.

    Article  CAS  Google Scholar 

  55. Lin X, Wang S, Sun M, Zhang C, Wei C, Yang C, et al. miR-195-5p/NOTCH2-mediated EMT modulates IL-4 secretion in colorectal cancer to affect M2-like TAM polarization. J Hematol Oncol. 2019;12:20.

    Article  Google Scholar 

  56. Zhong C, Yu Q, Peng Y, Zhou S, Liu Z, Deng Y, et al. Novel LncRNA OXCT1-AS1 indicates poor prognosis and contributes to tumorigenesis by regulating miR-195/CDC25A axis in glioblastoma. J Exp Clin Cancer Res. 2021;40:123.

    Article  CAS  Google Scholar 

  57. Yang B, Li L, Tong G, Zeng Z, Tan J, Su Z, et al. Circular RNA circ_001422 promotes the progression and metastasis of osteosarcoma via the miR-195-5p/FGF2/PI3K/Akt axis. J Exp Clin Cancer Res. 2021;40:235.

    Article  CAS  Google Scholar 

  58. Yang R, Xing L, Zheng X, Sun Y, Wang X, Chen J. The circRNA circAGFG1 acts as a sponge of mir-195-5p to promote triple-negative breast cancer progression through regulating CCNE1 expression. Mol Cancer. 2019;18:4.

    Article  Google Scholar 

  59. Boldrin E, Gaffo E, Niedermayer A, Boer JM, Zimmermann M, Weichenhan D, Claus R, et al. MicroRNA-497/195 is tumor suppressive and cooperates with CDKN2A/B in pediatric acute lymphoblastic leukemia. Blood. 2021;138:1953–65.

    Article  CAS  Google Scholar 

  60. Li L, Feng T, Zhang W, Gao S, Wang R, Lv W, et al. MicroRNA biomarker hsa-miR-195-5p for detecting the risk of lung cancer. Int J Genom. 2020;2020:7415909.

    Google Scholar 

Download references

Acknowledgements

We gratefully acknowledge Jianwei Xuan for supporting the SuValue database and Haixin Chen for supplying lung cancer samples in Hebei province.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 81973135), Science and Technology Commission of Shanghai Municipality (Grant No. 21XD1402600) and SJTU Medicine-Engineering Research Fund (Grant No. YG2019QNA71).

Author information

Author notes

  1. Tengteng Zhu, Yangyang Li and Tienan Feng contributed equally to this work

Authors and Affiliations

  1. School of Public Health, Shanghai Tongren Hospital, Hongqiao International Institute of Medicine, Shanghai Jiao Tong University School of Medicine, Shanghai, 200052, China

    Tengteng Zhu, Yangyang Li, Tienan Feng, Kai Zhang, Jing Gao, Xiaowei Quan, Ying Qian & Biyun Qian

  2. Shanghai Huangpu District Center for Disease Control and Prevention, Shanghai, 200002, China

    Yuqing Yang

  3. Cancer Epidemiology Program, University of Hawaii Cancer Center, Honolulu, HI, 999203, USA

    Herbert Yu

  4. Clinical Research Promotion and Development Center, Shanghai Hospital Development Center, 200040, Shanghai, China

    Biyun Qian

Authors
  1. Tengteng Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yangyang Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Tienan Feng
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Yuqing Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kai Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Jing Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Xiaowei Quan
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Ying Qian
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Herbert Yu
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Biyun Qian
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

TTZ and BYQ designed the study, YYL, YQY and KZ performed the experiments, JG, XWQ and YQ analysed the data, TNF helped with the study design, TTZ and TNF wrote the manuscript, BYQ and HY edited the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Biyun Qian.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Institutional Review Board at Tongren Hospital, Shanghai, China (No. 2019-077-02). The animal protocol used in this study was approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University (IACUC-A-2019-013). Collected data included clinical information and single nucleotide polymorphism results. No private information was used in this study, and patients did not receive extra medical intervention. Data were used only for research purposes. The content of the study was written in the informed consent form, which was signed by all patients. All acquired records and tissue used in the study were anonymized and could not be linked to any of the patients. Methods carried out in this study were in accordance with the approved guidelines.

Consent for publication

Written informed consent for publication was obtained from all participants.

Competing interests

The authors declare no competing financial interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhu, T., Li, Y., Feng, T. et al. d-Limonene inhibits the occurrence and progression of LUAD through suppressing lipid droplet accumulation induced by PM2.5 exposure in vivo and in vitro. Respir Res 23, 338 (2022). https://doi.org/10.1186/s12931-022-02270-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12931-022-02270-9

Keywords

Respiratory Research

ISSN: 1465-993X

Contact us