Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: Myeloid DNA methyltransferase3b deficiency aggravates pulmonary fibrosis by enhancing profibrotic macrophage activation

Specie Gene Forward Reverse
Mouse Arg1 CTGGGAATCTGCATGGGCAA GTCTACGTCTCGCAAGCCAA
Fizz1 CGTGGAGAATAAGGTCAAGGAAC CACAAGCACACCCAGTAGCAG
Spp1 GCCGAGGTGATAGCTTGGCTTATG CTCTCCTGGCTCTCTTTGGAATGC
Pdgfα CCAACCTGAACCCAGACCAT CAAAGACCGCACGCACATT
Mmp8 TTGCCCATGCCTTTCAACCA TGAGCAGCCACGAGAAATAGG
Mmp12 GGAACTTGCAGTCGGAGGGA AATTCACTGTCATTCATGGGAGCA
Fn1 AGAGGAGGCACAAGGTTCGG GACAACCGCTCCCACTCCTC
Il-6 CTTCCTACCCCAATTTCCAATGCT TCTTGGTCCTTAGCCACTCCTT
Tnf CGAGTGACAAGCCTGTAGCC CCTTGAAGAGAACCTGGGAGT
Hprt AGTCAAGGGCATATCCAACA CAAACTTTGCTTTCCGGGT