Skip to main content

Table 1 Nucleotide sequences of primers used for real-time PCR

From: TRIM72 promotes alveolar epithelial cell membrane repair and ameliorates lung fibrosis

Gene Direction Primer sequence GenBank
Accession #
Trim72 Forward
Reverse
5′- CCGGCAAGGCTAGATATCCA − 3′
5′- CTTCTGGTCTGAGCACTCCA − 3′
NM_001079932.3
a-SMA Forward
Reverse
5′- GCTGGTGATGATGCTCCCA − 3′
5′- GCCCATTCCAACCATTACTCC − 3’
XM_006526606.2
Fn1 Forward
Reverse
5’- GTGTAGCACAACTTCCAATTACGAA − 3′
5′- GGAATTTCCGCCTCGAGTCT − 3’
XM_006495697.3
Col1a1
Cdh1
Sftpc
Forward
Reverse
5’- CCAAGAAGACATCCCTGAAGTCA − 3′
5′- TGCACGTCATCGCACACA − 3′
NM_007742.4
Forward
Reverse
Forward
Reverse
5′- CAGCCTTCTTTTCGGAAGACT − 3′
5′- GGTAGACAGCTCCCTATGACTG − 3′
NM_009864.3
5′- GAAGATGGCTCCAGAGAGCATC − 3′
5′- GGACTCGGAACCAGTATCATGC − 3’
NM_011359.2
Hopx Forward
Reverse
5’- CAACAAGGTCAACAAGCACCC − 3′
5′- GGCGCTGCTTAAACCATTTCT − 3’
NM_175606.3
Aqp5 Forward
Reverse
5’- ATGAATCGGTTCAGCCCCTC − 3′
5′- TCGATGGTCTTCTTCCGCTC − 3’
NM_009701.4
Gadph Forward
Reverse
5’- CGACTTCAACAGCAACTCCCACTCTTCC − 3′
5′- TGGGTGGTCCAGGGTTTCTTACTCCTT − 3’
XM-017321385.1
  1. Trim72, tripartite motif-containing protein 72; a-SMA, alpha-smooth muscle actin; Fn1, fibronectin-1; Col1a1, collagen, type 1, alpha 1; Cdh1, E-Cadherin; Sftpc, surfactant protein C; Gapdh, glyceraldehyde 3-phosphate dehydrogenase