Skip to main content

Table 1 Primer and probe sequences used for the negative strand HRV-16 RT-PCR reactions

From: Rhinovirus replication and innate immunity in highly differentiated human airway epithelial cells

Name Purpose of oligonucleotide Sequence
Neg-Tag-cDNA Chimeric RT primer 5′- ATCAGCGATGCCGAACGTAT GGCAGCATGGGCAACCT-3′
Neg-HRV16-For Real-time PCR Forward Primer 5′-TGCTGATGCAATACTCAAAAAGG-3’
Tag-Rev Real-time PCR Reverse Primer 5′- ATCAGCGATGCCGAACGTAT -3’
Neg-Probe Real-time PCR Probe 5’FAM-TGAAAAGCGAGGGA-MGB3’
  1. Underlined nucleotides denote non-viral tag sequences