Skip to main content

Table 1 Primers for RT-qPCR

From: LncRNA H19 promotes the proliferation of pulmonary artery smooth muscle cells through AT1R via sponging let-7b in monocrotaline-induced pulmonary arterial hypertension

Gene Accession Number Species Primer Pair Sequence 5′ to 3′
H19 NR_027324 Rat  
Sense    GATGACAGGTGTGGTCAACG
Antisense    CAGACATGAGCTGGGTAGCA
H19 NR_130974 Mouse  
Sense    CCACCCACTCACTCAGGATT
Antisense    GGGCAGAAGAGAACTCACCT
AT1R NM_030985 Rat  
Sense    ACCAGGTCAAGTGGATTTCG
Antisense    ATCACCACCAAGCTGTTTCC
AT1R NM_175086 Mouse  
Sense    GCAGCAGGGAGTAACAGAGA
Antisense    TGGGGCAGTCATCTTGGATT
β-actin NM_031144 Rat  
Sense    TGTCACCAACTGGGACGATA
Antisense    ACCCTCATAGATGGGCACAG
β-actin NM_007393 Mouse  
Sense    ACTGGGACGACATGGAGAAG
Antisense    ATGGGAGAACGGCAGAAGAA
PCNA NM_022381 Rat  
Sense    AGGACGGGGTGAAGTTTTCT
Antisense    CAGTGGAGTGGCTTTTGTGA
PCNA NM_011045 Mouse  
Sense    GAGAGCTTGGCAATGGGAAC
Antisense    ACTCTACAACAAGGGGCACA
Ki67 NM_139186 Rat  
Sense    CATGGGGATTCTGAGGCTAA
Antisense    GGATCACTGCTTGCTCTTCC
Ki67 NM_001081117 Mouse  
Sense    GCCATAACCCGAAAGAGCAG
Antisense    CCAGTTTACGCTTTGCAGGT
5sRNA NR_033176 Rat GTCTACGGCCATACCACCCTGAAC
5sRNA NR_030686 Mouse CTACAGCACCCGGTATTCCC
Let-7b NR_031802 Rat TGAGGTAGTAGGTTGTGTGGTT
Let-7b NR_029727 Mouse TGAGGTAGTAGGTTGTGTGGTT
universal r   Rat/Mouse GCTGTCAACGATACGCTACGTAACG
Anchor RT   Rat/Mouse GCTGTCAACGATACGCTACGTAACGGCATGACAGTG-ttttttttttttttttttttttttG
Let-7b mimic   Rat  
Sense    UGAGGUAGUAGGUUGUGUGGUU
Antisense    AACCACACAACCUACUACCUCA
Mimic control   Rat  
Sense    UUUGUACUACACAAAAGUACUG
Antisense    CAGUACUUUUGUGUAGUACAAA
Let-7b inhibitor   Rat AACCACACAACCUACUACCUCA
Inhibitor control   Rat UUUGUACUACACAAAAGUACUG
si-H19   Rat  
Sense    CCUUUCCUGUAACUCUAUATT
Antisense    UAUAGAGUUACAGGAAAGGTT
si-AT1R   Rat  
Sense    GCAAUGUAUGUUUACCUCUAATT
Antisense    UUAGAGGUAAACAUACAUUGCTT
GAPDH NM_017008 Rat  
Sense    GAGACAGCCGCATCTTCTTG
Antisense    TGACTGTGCCGTTGAACTTG
GAPDH NM_001289726 Mouse  
Sense    CAACTCCCACTCTTCCACCT
Antisense    GAGTTGGGATAGGGCCTCTC