Skip to main content

Table 1 Primers used for detection of gene expression

From: Lack of SOCS3 increases LPS-induced murine acute lung injury through modulation of Ly6C(+) macrophages

Gene Sense (5′-3′) Antisense (5′-3′)
mSOCS3 GATTTCGCTTCGGGACTAG CGGCGGCGGGAAACTTGCTG
mIL-1beta AGAGCTTCAGGCAGGCAGTA AGGTGCTCATGTCCTCATCC
mIL-6 CAACGATGATGCACTTGC GTACTCCAGGTAGCTATG
mMCP-1 CCAGCAAGATGATCCCAATG TTCTTGGGGTCAGCACAGAC
mCXCL15 TGGATCCTGATGCTCCATGG AGAGGCTTTTCATGCTCAAC
mGAPDH TGTTCCTACCCCCAATGTGT TGTGAGGGAGATGCTCAGTG
Floxp-A/B CGGGCAGGGGAAGAGACTGT GGAGCCAGCGTGGATCTGC
Floxp-A/C CGGGCAGGGGAAGAGACTGT AGTCCGCTTGTCAAAGGTATTGTCCCAC
Cre-D/E CCCAGAAATGCCAGATTACG CTTGGGCTGCCAGAATTTCTC
Cre-F/E TTACAGTCGGCCAGGCTGAC CTTGGGCTGCCAGAATTTCTC