Skip to main content

Table 1 Sequence of primers used in the study

From: C-type natriuretic peptide ameliorates pulmonary fibrosis by acting on lung fibroblasts in mice

Genes Forward (5′-3′) Reverse (5′-3′)
IL-1β AGCACCTTCTTTCCCTTCATCTTTG GAGGTGGAGAGCTTTCAGTTCATAT
IL-6 CCAGTTGCCTTCTTGGGACTGATG GTAATTAAGCCTCCGACTTGTGAAG
bFGF GCTCTACTGCAAGAACGGCGGCTTC ACACACTTAGAAGCCAGCAGCCGTC
Collagen 1A AGTAACGTCGTGCCTAGCAACATGC GAATACTGAGCAGCAAAGTTCCCAG
TIMP-1 ATCATCGAGACCACCTTATACCAGC TGCAGGCAGTGATGTGCAAATTTCC
TGF-β CAACTACTGCTTCAGCTCCACAGAG CAAGGACCTTGCTGTACTGTGTGTC
α-SMA TGCTGGCATCCATGAAACCA GTTTGCTGATCCACATCTGC
SM22α CCCTCCATGGTCTTTAAGCAGATGGA TCATAAACCAGTTGGGATCTCCACGG
GC-B GTCGCTGCGGGGATCCAGTTACG ATGTTGGGAGGGTCTATGCAGGC
36B4 TCATTGTGGGAGCAGACAATGTGGG AGGTCCTCCTTGGTGAACACAAAGC