Skip to main content

Table 1 Primers and probes used for real-time PCR of mouse lung RNA

From: Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma

Gene Primer/Probe Sequences
Gob-5  
forward 5' GAGTGGGCTCACTTCCGATG 3'
reverse 5' GCTGAACACCTCACTGCTTGG 3'
Probe 5' CAACAACGACGAGAAGTTCTACTTATCCAAAGG 3'
Muc5-ac  
forward 5' CCAGCACCATCTCTACAACCC 3'
reverse 5' GCAAAGCTCCTGTTTGCACTC 3'
Probe 5' CCCAAACTATCTCAACCTCAGGGTCCACC 3'
MIP3-α  
forward 5' CCTTGCTTTGGCATGGGTACT 3'
reverse 5' TCGTAGTTGTTGCTGTTCTG 3'
Probe 5' CTGGCTCACCTCTGCAGCCAG 3'
TGF-β  
forward 5' GACCCTGCCCCTATATTTGGA 3'
reverse 5' CGCCCGGGTTGTGTTG 3'
Probe 5' CACAGTACAGCAAGGTCCTTGCCCTCTACA 3'