Skip to main content

Table 1 Oligonucleotide primers for cav-1, cav-2 and β-MG (β-2-microglobulin) in RT-PCR analysis

From: Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM

Gene GenBank accession NO Primer Product length (bp) Position of amplified DNA (bp)
cav-1 Z46614.1 Forward: CAGCATGTCTGGGGGTAAAT
123 25–147
cav-1 Z46614.1 Forward: GGCTAGCTTCACCACCTTCA
121 165–285
cav-2 BC062059.1 Forward: TGTTTCTAGCCATCCCCTTG
106 392–497
cav-2 BC062059.1 Forward: CCTACAGCCACCACAGTGTC
127 176–302
191 147–337