Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used for RT-PCR

From: Aggravation of myocardial dysfunction by injurious mechanical ventilation in LPS-induced pneumonia in rats

HSP70 Forward AGGTGGATTAGAGGCTCTTT
Reverse AACCTAGGACTTGATTGCAGA
TNFα Forward ACAAGCCCGTAGCCCACGTC
Reverse AGGAGCACGTAGTCGGGGCA
IL6 Forward GTCTCGAGCCCACCAGGAACG
Reverse AAGCCTCCGACTTGTGAAGTGGT
IL1β Forward GAGCCCGTCCTCTGTGACTCGT
Reverse AGGCCCAAGGCCACAGGGATT
CXCL1 Forward TCGCCAATGAGCTGCGCTGT
Reverse CAAGGCAAGCCTCGCGACCAT
TLR2 Forward GGGAAGGCCATTCTGCCCAGG
Reverse CGGAGGTTCACACAGGCTCGC
β-actin Forward GGCCAACCGTGAAAAGATGA
  Reverse GGACAACACAGCCTGGATGG