Skip to main content

Table 2 Primers used for quantitative real time PCR

From: IL-4 and IL-13 exposure during mucociliary differentiation of bronchial epithelial cells increases antimicrobial activity and expression of antimicrobial peptides

Name Primer Sequence Melting Temperature (°C) Product size (base pairs)
β-actin F: TGCGTGACATTAAGGAGAAG
R: TGAAGGTAGTTTCGTGGATG
63 213
GAPDH F: TTCCAGGAGCGAGATCCCT
R: CACCCATGACGAACATGGG
62 259
hCAP18/LL-37 F: TCATTG CCCAGGTCCTCAG
R: TCCCCATACACCGCTTCAC
64.3 249
MUC5AC F: CCTTCGACGGACAGAGCTAC
R: TCTCGGTGACAACACGAAAG
63.5 111
SLPI F: CCAGGGAAGAAGAGATGTTG
R: CCTCCATATGGCAGGAATC
61 226
Elafin F: CCGCTGCTTGAAAGATACTG
R: GAATGGGAGGAAGAATGGAC
59.2 177