Skip to main content

Advertisement

Table 1 Real-time primer sequences and basal levels of transcript expression in normal human lung fibroblasts

From: Bone Morphogenetic Protein (BMP)-4 and BMP-7 regulate differentially Transforming Growth Factor (TGF)-β1 in normal human lung fibroblasts (NHLF)

GenBank Identifier Gene Forward Primer Reverse Primer Basal Ct
NM_001105 ALK-2 CGGGAGATGACCTGTAAGACCCCG GGGCCGTGATGTTCCTGTTAC 25.00 ± 0.70
NM_004329 ALK-3 CAGAAACCTATTTGTTCATCATTTCTCG ATCCCAGTGCCATGAAGCATAC 21.97 ± 0.82
NM_001203 ALK-6 CGAATGGGGTGTAGGTCTTTATTACATTCG CCCATTCCTCATCAAAGAAGATCA 26.50 ± 0.93
NM_001204 BMPRII CGGTTTCCACCTCATTCATTTAACCG ACAGAGACTGATGCCAAAGCAAT 24.93 ± 0.42
NM_000088 COL1a1 CTTTGCATTCATCTCTCAAACTTAGTTTT CCCCGCATGGGTCTTCA 19.03 ± 0.69
NM_001845 COL4a1 CTAATCACAAACTGAATGACTTGACTTCA AAATGGCCCGAATGTGCTTA 19.87 ± 0.95
X02761 Fibronectin TGGACCAGAGATCTTGGATGTTC CGCCTAAAACCATGTTCCTCAA 21.70 ± 0.79
X56160 Tenascin C GGTCCACACCTGGGCATTT TTGCTGAATCAAACAACAAAACAGA 17.00 ± 0.92
NM_001613 αSMA CCGACCGAATGCAGAAGGA ACAGAGTATTTGCGCTCCGAA 20.60 ± 0.10
NM_021009 UBC CACTTGGTCCTGCGCTTGA TTTTTTGGGAATGCAACAACTTT 17.50 ± 1.35
NM_012423 RPL13A CCTGGAGGAGAAGAGGAAAGAGA TTGAGGACCTCTGTGTATTTGTCAA 19.65 ± 0.31
NM_004168 SDHA TGTGTCCATGTCATAACTGTCTTCATA AAGAATGAAGCAAGGGACAAAGG 19.00 ± 0.91