Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequence and description of the genes selected for the study

From: Collagen V-induced nasal tolerance downregulates pulmonary collagen mRNA gene and TGF-beta expression in experimental systemic sclerosis

Gene Genbank Accession Number Primer sense (5'-3') Primer antisense (5'-3') Product size (pb)
COL I AY633663 CTTGGGGTTCTTGCTGATGT GGACCTCAAGATGTGCCACT 178
COL III S83371 ATGTGTTTGGTGGAACAGCA TGGCCCTGTTTGCTTTTTAT 204
COL V AF451329 GTCCCCCTCAAACACTTCCT TCTCAGCGTCCACAAGAAAA 154
GAPDH AB231852 GTGAGTTTCCCGTTCAGCTC AGGTCATCCACGACCACTTC 202