Skip to main content

Table 1 Primer information

From: Human epididymis protein 4 aggravates airway inflammation and remodeling in chronic obstructive pulmonary disease

Genes Primer pairs (5′–3′)
Human HE4 AGAACTGCACGCAAGAGTG
TTGAGGTTGTCGGCGCATT
Human β-actin AGAAAATCTGGCACCACACCT
GATAGCACAGCCTGGATAGCA
Human IL-6 CTGCTGCCTTCCCTGCC
CCTCTTTGCTGCTTTCACACAT
Human IL-8 AAGAAACCACCGGAAGGAAC
ACTCCTTGGCAAAACTGCAC
Human Fibronectin GAGAATAAGCTGTACCATCGCAA
CGACCACATAGGAAGTCCCAG
Human Collagen I GAGGGCCAAGACGAAGACATC
CAGATCACGTCATCGCACAAC
Human α-SMA GTGTTGCCCCTGAAGAGCAT
GCTGGGACATTGAAAGTCTCA
Mouse he4 GTTGCTACTGTTCACCCCCA
GGTGCCCTGCTTTTCATTAGG
Mouse β-actin AGAAAATCTGGCACCACACCT
GATAGCACAGCCTGGATAGCA