Skip to main content

Table 1 Primer sequences used in the present study

From: ZDHXB-101 (3′,5-Diallyl-2, 4′-dihydroxy-[1,1′-biphen-yl]-3,5′-dicarbaldehyde) protects against airway remodeling and hyperresponsiveness via inhibiting both the activation of the mitogen-activated protein kinase and the signal transducer and activator of transcription-3 signaling pathways

GenesPrimer Sequences (5′-3′)
IL-13Sense: CCTCTGACCCTTAAGGAGCTTAT
Antisense: CGTTGCACAGGGGAGTCT
IL-17Sense: GAGAAGATGCTGGTGGGTGT
Antisense: TTTCATTGTGGAGGGCAGAC
MMP-9Sense: GTATGGTCGTGGCTCTAAGC
Antisense: AAAACCCTCTTGGTCTGCGG
N-CadherinSense: CGGTGCCATCATTGCCATCCT
Antisense: AGTCATAGTCCTGGTCTTCTTCTCCT
TwistSense: TACGCCTTCTCCGTCTGG
Antisense: CTAGTGGGACGCGGAC
β-actinSense: GGCTGTATTCCCCTCCATC
Antisense: ATGCCATGTTCAATGGGGTA