Skip to main content

Table 2 PCR primer sequences

From: Cisplatin treatment induced interleukin 6 and 8 production alters lung adenocarcinoma cell migration in an oncogenic mutation dependent manner

Target geneForward primerReverse primer
human β-actinGCGCGGCTACAGCTTCACTTAATGTCACGCACGATTTCC
human IL-6AGGGCTCTTCGGCAAATGTAGAAGGAATGCCCATTAACAACAA
human IL-8CAGTTTTGCCAAGGAGTGCTAAACTTCTCCACAACCCTCTGC