Skip to main content

Table 1 Primer sequences

From: MiR-223 plays a protecting role in neutrophilic asthmatic mice through the inhibition of NLRP3 inflammasome

Gene name Forward primer Reverse primer
miR-223 GCGCGTGTCAGTTTGTCAAAT AGTGCAGGGTCCGAGGTATT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
NLRP3 GACCAGCCAGAGGTGGAATGA CTGCGTGTAGCGACTGTTGA
ASC CACCAGCCAAGACAAGATGA CTCCAGGTCCATCACCAAGT
Caspase-1 AACAGAACAAAGAAGATGGCACA CCAACCCTCGGAGAAAGAT
IL-1β AGTTGACGGACCCCAAAAG CTTCTCCACAGCCACAATGA
IL-18 TGGAGACCTGGAATCAGACA TGGGGTTCACTGGCACTT
GAPDH TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG