Skip to main content

Table 1 Primer sequences of each gene

From: SN50 attenuates alveolar hypercoagulation and fibrinolysis inhibition in acute respiratory distress syndrome mice through inhibiting NF-κB p65 translocation

GeneForward(5’-3’)Reverse(3’-5’)Primer Length (bp)
TFAATGGGCAGATAGAGTGTACCGCATTCAAGTCA182
PAI-1ACCAACTTCGGAGTAAAATTGAATCCCATAGCATCT158