Skip to main content

Table 1 Primers for qRT-PCR analysis are listed. “CEBPA” primers were used to measure human fibroblast endogenous gene expression, and “Cebpa” primers used to detect the expression of pScalps_Puro_mCebpa plasmid

From: Targeted regulation of fibroblast state by CRISPR-mediated CEBPA expression

gene namesSequences
GAPDH-FAATGAAGGGGTCATTGATGG
GAPDH-RAAGGTGAAGGTCGGAGTCAA
CEBPA-FGCAAACTCACCGCTCCAATG
CEBPA-RGGAAGGAGGCAGGAAACCTC
ACTA2-FGTGTTGCCCCTGAAGAGCAT
ACTA2-RGCTGGGACATTGAAAGTCTCA
COL1Α1-FGAGGGCCAAGACGAAGACATC
COL1Α1-RCAGATCACGTCATCGCACAAC
FN1-FAGGAAGCCGAGGTTTTAACTG
FN1-RAGGACGCTCATAAGTGTCACC
CTGF-FCAGCATGGACGTTCGTCTG
CTGF-RAACCACGGTTTGGTCCTTGG
PLIN2-FATGGCAGAGAACGGTGTGAAG
PLIN2-RCAACTGCAATTTGCGGCTC
PPARA-FGCTTTCTGGGTGGACTCAAGT
PPARA-RGAGGGCAATCCGTCTTCATCC
PPARG1-FGGGATCAGCTCCGTGGATCT
PPARG1-RTGCACTTTGGTACTCTTGAAGTT
PPARGC1A-FGCTTTCTGGGTGGACTCAAGT
PPARGC1A-RGAGGGCAATCCGTCTTCATCC
Cebpa-fCAAGAACAGCAACGAGTACCG
Cebpa-rGTCACTGGTCAACTCCAGCAC