Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Real-time PCR templates and primers used for gene manipulation

From: Lipoxin A4 ameliorates lipopolysaccharide-induced lung injury through stimulating epithelial proliferation, reducing epithelial cell apoptosis and inhibits epithelial–mesenchymal transition

Gene symbol Forward primer (5′-3′) Reverse primer (5′-3′)
SNAIL CCTCTCACTGGGTCTTCTGG GGTCTTCTTCCGCTCCTCTC
AQP5 GCTGCCATCCTTTACTTCTACC GGTCTTCTTCCGCTCTTCC
FIBRONECTIN CCAAGCAGGAGTCAAACGAG TCTTCCATCTCACGCATCTG
α-SMA CCGACCGAATGCAGAAGGA ACAGAGTATTTGCGCTCCGAA
CDH1 GGTCTCTCTCACCACCTCCA CCTCGGACACTTCCACTCTC
CDH2 CGTGAAGGTTTGCCAGTGT CAGCACAAGGATAAGCAGGA
SP-C CCTTCTTATCGTGGTGGTGGT TCTCCGTGTGTTTCTGGCTCAT
GAPDH GACAACAGCCTCAAGATCATCAG ATGGCATGGACTGTGGTCATGAG