Skip to main content

Table 3 Mouse primers of cytokines for RT-qPCR

From: LncRNA H19 promotes the proliferation of pulmonary artery smooth muscle cells through AT1R via sponging let-7b in monocrotaline-induced pulmonary arterial hypertension

Gene Accession Number Species Primer Pair Sequence 5′ to 3′
IL-1α NM_010554 Mouse  
Sense    AGCAGCCTTATTTCGGGAGT
Antisense    ATCATATGTCGGGGTGGCTC
IL-1β NM_008361 Mouse  
Sense    GGCTCATCTGGGATCCTCTC
Antisense    TCATCTTTTGGGGTCCGTCA
PDGF-AA NR_156469 Mouse  
Sense    GATCCACCTCGCATCATCTT
Antisense    GTTCCCGACAGGAAAACTCA
PDGF-BB NM_011057 Mouse  
Sense    GATCTCTCGGAACCTCATCG
Antisense    GGCTTCTTTCGCACAATCTC
IL-6 NM_031168 Mouse  
Sense    CTGGGGATGTCTGTAGCTCA
Antisense    CTGTGAAGTCTCCTCTCCGG
TNF-α NM_013693 Mouse  
Sense    GACCCCTTTACTCTGACCCC
Antisense    AGGCTCCAGTGAATTCGGAA
VEGF NM_001287056 Mouse  
Sense    GCTGTAACGATGAAGCCCTG
Antisense    TCGTCTTCTCACCCTCAACC