Skip to main content

Table 2 Rat primers of cytokines for RT-qPCR

From: LncRNA H19 promotes the proliferation of pulmonary artery smooth muscle cells through AT1R via sponging let-7b in monocrotaline-induced pulmonary arterial hypertension

Gene Accession Number Species Primer Pair Sequence 5′ to 3’
IL-1α NM_017019 Rat  
Sense    TCGGGAGGAGACGACTCTAA
Antisense    GAAAGCTGCGGATGTGAAGT
IL-1β NM_031512 Rat  
Sense    CTGTGACTCGTGGGATGATG
Antisense    GGGATTTTGTCGTTGCTTGT
PDGF-AA NM_012801 Rat  
Sense    ATGCCTTGGAGACAAACCTG
Antisense    GTCAAGAAGTTGGCCGATGT
PDGF-BB NM_031524 Rat  
Sense    ATCGAGCCAAGACACCTCAA
Antisense    ATCACTCCAAGGACCCCATG
IL-6 NM_012589 Rat  
Sense    CTCATTCTGTCTCGAGCCCA
Antisense    CTGTGAAGTCTCCTCTCCGG
TNF-α NM_012675 Rat  
Sense    CAAACCACCAAGCAGAGGAG
Antisense    GAGGCTGACTTTCTCCTGGT
VEGF NM_001287107 Rat  
Sense    GCAATGATGAAGCCCTGGAG
Antisense    GCTCTGAACAAGGCTCACAG