Skip to main content

Table 1 Primer table for Real-Time Quantitative Reverse-Transcriptase PCR (qRT-PCR). Primers were synthesized by MWG Eurofins (Ebersberg, Germany).

From: FK506-binding protein 10 (FKBP10) regulates lung fibroblast migration via collagen VI synthesis

Target Species Forward primer (5′-3′) Reverse primer (5′-3′)
CAPNS1 human GACGCTACTCAGATGAAAGT TCTTTGTCAAGAGATTTGAAG
CAV1 human TCACTGTGACGAAATACTG CGTAGATGGAATAGACACG
COL6A1 human GACGCACTCAAAAGCA ATCAGGTACTTATTCTCCTTCA
COL6A2 human AGAAAGGAGAGCCTGCGGAT AGGTCTCCCTCACGTAGGTC
COL6A3 human CTCTACCGAGCCCAGGTGTT ATGAGGGTGCGAACGTACTG
CORO1C human GTTAACAAATGTGAGATTGC TGGAAAAGGTCAGACTTC
DHX8 human TGACCCAGAGAAGTGGGAGA ATCTCAAGGTCCTCATCTTCTTCA
ERK1 human TTCGAACATCAGACCTACT AGGTCCTGCACAATGTAG
FBLN1C human GCCCTGAGAACTACCG GAGAGGTGGTAGTAGGTTATTC
FKBP10 human CGACACCAGCTACAGTAAG TAATCTTCCTTCTCTCTCCA
ITGB1 human TTACAAGGAGCTGAAAAACT AAAATGACTTCTGAGGAAAG
TLN1 human GCTCTTTCTGTCAGATGAT CATAGTGTCCCCATTTC