Skip to main content

Table 1 Sequences of the Different Primers

From: Crocin attenuates cigarette smoke-induced lung injury and cardiac dysfunction by anti-oxidative effects: the role of Nrf2 antioxidant system in preventing oxidative stress

mRNA Sense Primers Antisense Primers
Nrf2 CTCTCTGGAGACGGCCATGACT CTGGGCTGGGGACAGTGGTAGT
GCLc GTGGACACCCGATGCAGTAT TCATCCACCTGGCAACAGTC
HO-1 CGTGCAGAGAATTCTGAGTTC AGACGCTTTACGTAGTGCTG
TNF-α ACTGAA CTT CGG GGT GAT TG GCT TGG TGG TTT GCT ACG AC
IL-6 TGATGG ATG CTT CCA AAC TG GAGCAT TGG AAG TTG GGG TA
PKC TGGACCCCACGACAACTTTC ACTTCGTCCCTGCCCTGAC
MAPK GGAGCAGTATTATGACCCAAGTGA TCGTCCACTCCATGTCAAACT
PI3K AACACAGAAGACCAATACTC TTCGCCATCTACCACTAC
GAPDH GTATTG GGC GCC TGG TCA CC CGCTCCTGGAAGATGGTGATGG