Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Sequences of primers used for RT-qPCR to assess expression of the indicated genes

From: Pulmonary inflammation-induced loss and subsequent recovery of skeletal muscle mass require functional poly-ubiquitin conjugation

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
Cyclophilin A TTCCTCCTTTCACAGAATTATTCCA CCGCCAGTGCCATTATGG
Beta-2-microglobulin CTTTCTGGTGCTTGTCTCACTGA GTATGTTCGGCTTCCCATTCTC
GAPDH CAACTCACTCAAGATTGTCAGCAA TGGCAGTGATGGCATGGA
RPLP0 GGACCCGAGAAGACCTCCTT GCACATCACTCAGAATTTCAATGG
GUSB CATTAGCAAGCTGGTCCAGAGT GACAAAGTAACCCTTGGGATACAT
MuRF1 CTTCCTCTCAAGTGCCAAGCA GTGTTCTAAGTCCAGAGTAAAGTAGTCCAT
Atrogin-1 CAGCAGCTGAATAGCATCCAGAT TCTGCATGATGTTCAGTTGTAAGC
LC3B GAGCAGCACCCCACCAAGAT CGTGGTCAGGCACCAGGAA
p62/SQSTM1 GAATGTGGGGGAGAGTGTGG TCTTCTGTGCCTGTGCTGGA
REDD1 TCGGCGCTTCACTACTGACC CCTAACACCCACCCCATTCC
FoXO1 AAGAGCGTGCCCTACTTCAAGGATA CCATGGACGCAGCTCTTCTC
IL-6 GTATGAACAACGATGATGCACTTG GAAGACCAGAGGAAATTTTCAATAGG
TNF-α CAGCGCTGAGGTCAATCTGCC TGCCCGGACTCCGCAA
CXCL1 TCGTCTTTCATATTGTATGGTCAACACG TGCCCTACCAACTAGACACAAAATGTC