Skip to main content

Advertisement

Table 1 Sequence of primers used in the study

From: Atrial natriuretic peptide protects against bleomycin-induced pulmonary fibrosis via vascular endothelial cells in mice

Gene Forward (5′-3′) Reverse (5′-3′)
IL-1β AGCACCTTCTTTCCCTTCATCTTTG GAGGTGGAGAGCTTTCAGTTCATAT
IL-6 CCAGTTGCCTTCTTGGGACTGATG GTAATTAAGCCTCCGACTTGTGAAG
MCP-1 GCAGGTGTCCCAAAGAAGCTGTAGT CAGAAGTGCTTGAGGTGGTTGTGGA
bFGF GCTCTACTGCAAGAACGGCGGCTTC ACACACTTAGAAGCCAGCAGCCGTC
Collagen 1A AGTAACGTCGTGCCTAGCAACATGC GAATACTGAGCAGCAAAGTTCCCAG
TIMP-1 ATCATCGAGACCACCTTATACCAGC TGCAGGCAGTGATGTGCAAATTTCC
TGF-β CAACTACTGCTTCAGCTCCACAGAG CAAGGACCTTGCTGTACTGTGTGTC
CTGF CAAGTTTGAGCTTTCTGGCTGCACCAG GGACAGTTGTAATGGCAGGCACAGG
36B4 TCATTGTGGGAGCAGACAATGTGGG AGGTCCTCCTTGGTGAACACAAAGC