Skip to main content

Table 1 Primer pairs used for PCR of cDNA from CSC-treated NHBEs and A549 cells

From: Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells

Name Forward primer sequence (5'→3') Reverse primer sequence (5'→3')
SICAM-1 Atggctcccagcagcccc cacctggcagcgtagggt
Il-1b Gacctggacctctgccctctg aggtattttgtcattactttc
RANTES tgaaggtctccgcggcacgcct ctagctcatctccaaagagttg
IL-6 Aactccttctccacaagcg tggactgcaggaactcctt
IL-8 Atttctgcagctctgtgtaa tcctgtggcatccacgaaact
GM-CSF Atgtggctgcagagcctgc tcactcctggactggctcc
GAPDH atggggaaggtgaaggtcgga gagatgatgacccttttggc