Skip to main content

Table 1 Primers used for real-time polymerase chain reaction analysis of gene expression.

From: IFN-γ, IL-4 and IL-13 modulate responsiveness of human airway smooth muscle cells to IL-13

Gene Forward primer (5' to 3') Reverse primer (5' to 3') Product length (bp)
IL-13Rα1 atctcacccccagaaggtgat cgggactggtattccttc 119
IL-13Rα2 cctttgccgccagtctatctta tcaaaacaccttgctggaatagg 108
IL-4Rα gctatgtcagcatcaccaagattaa cccctgagcatcctggattat 101
SOCS-1 ggaactgctttttcgccctta agcagctcgaagaggcagtc 127
SOCS-3 gtccccccagaagagcctatta ttgacggtcttccgacagagat 118