Table 1 Primers used for real-time polymerase chain reaction analysis of gene expression.
From: IFN-γ, IL-4 and IL-13 modulate responsiveness of human airway smooth muscle cells to IL-13
Gene | Forward primer (5' to 3') | Reverse primer (5' to 3') | Product length (bp) |
|---|---|---|---|
IL-13Rα1 | atctcacccccagaaggtgat | cgggactggtattccttc | 119 |
IL-13Rα2 | cctttgccgccagtctatctta | tcaaaacaccttgctggaatagg | 108 |
IL-4Rα | gctatgtcagcatcaccaagattaa | cccctgagcatcctggattat | 101 |
SOCS-1 | ggaactgctttttcgccctta | agcagctcgaagaggcagtc | 127 |
SOCS-3 | gtccccccagaagagcctatta | ttgacggtcttccgacagagat | 118 |