Skip to main content

Advertisement

Table 1 RT-PCR primers, conditions and products

From: Attenuation of acute lung inflammation induced by cigarette smoke in CXCR3 knockout mice

RT-PCR Genes S/AS Primer sequence (5' to 3') Tm(°C) Product (bp)
CXCL9 S CTTGGGCATCATCTTCCT G 55 352
  AS TGAACGACGACGACTTTGG   
CXCL10 S GTCATTTTCTGCCTCATCC 55 273
  AS GAGCCCTTTTAGACCTTTT   
CXCL11 S CTGCTCAAGGCTTCCTTATGTT 55 166
  AS CCTTTGTCGTTTATGAGCCTTC   
IFNγ S CATCTTGGCTTTGCAGCTCTT 55 363
  AS CTGGACCTGTGGGTTGTTGA   
Granzyme-A S GAAACCAGGAACCAGATGC 55 390
  AS GTGACAGGGATGGAGTGAA   
Granzyme-B S CCCTCTGCCTTCTTCCTC 55 344
  AS CTGGGTCTTCTCCTGTTCTT   
Perforin S ATGGCACGCACTTTATCAC 55 413
  AS CTTCGGGTTCTGTTCTTCC   
β-actin S CTTCCTTAATGTCACGCACGATTTC 55 541
  AS GTGGGGCGGCCCAGGCACCA   
  1. S, sense; AS, antisense