Skip to main content

Table 2 Primer sequences used for qPCR

From: Lung fibroblasts from patients with emphysema show markers of senescence in vitro

HUGO ID 5'- sense primer- 3' 5'- antisense primer – 3' product (bp) Sequence ID
PBGD [26] CACACAGCCTACTTTCCAAGC TTCAATGTTGCCACCACACT 155 NM_000190.2
IGFBP-3 CCTGCCGTAGAGAAATGGAA GAAGGGCGACACTGCTTT 127 NM_000598
IGFBP-5 GAGCAAGTCAAGATCGAGAGAGA GAAAGTCCCCGTCAACGTA 463 M65062
IGFBP-rP1 CTGCGAGCAAGGTCCTTCCATA CAGGTTGTCCCGGTCACCA 184 NM_001553
CTGF [22] CCTGCAGGCTAGAGAAGCAGA TGCACTTTTTGCCCTTCTTAATGT 90 NM_001901
Cyr61 ACACCAAGGGGCTGGAATG TGGGGACACAGAGGAATG 193 AF31385
LOXL2 CGGAGGATGTCGGTGTGGT GCTTGCGGTAGGTTGAGAGG 150 NM_002318
OAZ1 AGGTGGGCGAGGGAATAG ATGCGTTTGGCGTCTGTG 150 U09202
FOSL1 CAGGCGGAGACTGACAAA GGGAAAGGGAGATACAAGGT 217 NM_005438
CDK4 TGCAGTCCACATATGCAACAC CAGCCCAATCAGGTCAAAG 137 M14505