Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotides for real-time quantitative RT-PCR

From: Global expression profiling of theophylline response genes in macrophages: evidence of airway anti-inflammatory regulation

mRNA targets Oligonucleotides (5'→3') a Product size (bp)
IL-5 F180: ATAGCCAATGAGACTCTGAGGATTC 89
  R268: AGTGTGCCTATTCCCTGAAAGAT  
IL-13 F155: TGAGGAGCTGGTCAACATCA 76
  R230: CAGGTTGATGCTCCATACCAT  
IL-18 F211: GCTGAACCAGTAGAAGACAATTGC 94
  R304: CCAGGTTTCATCATCTTCAGCTA  
IL-13Rα1 F495: GGAATACCAGTCCCGACACTAACT 93
  R587: GGCCTTCTCTAAAGATGTTTTCACA  
IL-13Rα2 F44: GGCTATTTGAAGTCGCCATAACC 78
  R121: AGATTTAAAACCTTGATATTGCCTCTCT  
TNF-α F414: CTCGAACCCCGAGTGACAA 64
  R477: AGCTGCCCCTCAGCTTGA  
VEGF-a F1200: AACACACACTCGCGTTGCAA 69
  R1268: CGGCTTGTCACATCTGCAAGT  
VEGF-c F1193: AGATGCCTGGCTCAGGAAGA 74
  R1266: ATGTCATGGAATCCATCTGTTGAGT  
GM-CSF F119: GCCCTGGGAGCATGTGAA 78
  R196: TTCATCTCAGCAGCAGTGTCTCTA  
TBP F852: CACGAACCACGGCACTGATT 89
  R940: TTTTCTTGCTGCCAGTCTGGAC  
  1. a F and R indicate forward and reverse primers, respectively. Numbers indicate the mRNA sequence position.