Skip to main content

Table 2 Real-time PCR primers used for mRNA quantification

From: Budesonide and formoterol effects on rhinovirus replication and epithelial cell cytokine responses

Target gene Sequence( 5’-3’) Primer length Amplicon size (bp)
PPIA-f TCATCTGCACTGCCAAGACTG 21  
PPIA-r CATGCCTTCTTTCACTTTGCC 21 71
IFNB1-f AGGACGCCGCATTGACC 17  
IFNB1-r ATTCCAGCCAGTGCTAGATGA 21 83
IL28-f GCTGACCGTGACTGGAGCA 19  
IL28-r GACAGGGACTTGAACTGGGCTA 22 93
TNF-f TCGGCCCGACTATCTCGAC 19  
TNF-r GCGTTTGGGAAGGTTGGAT 19 94
CXCL10-f AAGCTCTACTGAGGTGCTATGTT 23  
CXCL10-r TGGGAAAGGTGAGGGAAATA 20 72
CXCL8-f CAGTTTTGCCAAGGAGTGCTAA 22  
CXCL8-r GGTGGAAAGGTTTGGAGTATGTC 23 69
  1. Definition of abbreviations: f, forward primer; r, reverse primer; bp, base pairs.
  2. The PPIA primer sequences were published by RTPrimerDB, ID #3460 (http://medgen.ugent.be/rtprimerdb/).