Skip to main content

Table 1 Primers used in the detection of cytokine expression from mouse lung homogenates

From: Acrolein exposure suppresses antigen-induced pulmonary inflammation

Gene Sense (5′-3′) Antisense (5′-3′)
Muc5ac AGTCTCTCTCCGCTCCTCTCAAT CAGCCGAGAGGAGGGTTTGATCT
Il4 GGCATTTTGAACGAGGTCAC ATCGAAAAGCCCGAAAGAGT
Il13 AGGAGCTGAGCAACATCACA GTGGGCTACTTCGATTTTGG
Il12b ACGGCCAGAGAAAAACTGAA CTACCAAGGCACAGGGTCAT
Tnf TGGAAGACTCCTCCCAGGTA ACGGCATGGATCTCAAAGAC
Gclm ACCTGGCCTCCTGCTGTGTG GGTCGGTGAGCTGTGGGTGT