Skip to main content

Table 1 Primers used for RT-PCR

From: IL-4 and IL-13 exposure during mucociliary differentiation of bronchial epithelial cells increases antimicrobial activity and expression of antimicrobial peptides

Name Primer sequence Melting temperature (°C) MgCl 2 (mM) Product size (base pairs)
β-actin F:GGAAGGCTGGAAGAGTGC
R:CTACAATGAGCTGCGTGTGG
56 2 528
hCAP18/LL-37 F:GGCTCCTTTGACATCAGTT
R:CTGTCCTGGGTACAAGATTCC
55 2.5 150
hBD-2 F:ATCAGCCATGAGGGTCTTG
R:GCAGCATTTTGTTCCAGG
62 2 190
hBD-3 F:AGCCTAGCAGCTATGAGGATC
R:CTTCGGCAGCATTTTGCGCCA
62 2 206
MUC5AC F:ATTTTTTCCCCACTCCTGATG
R:AAGACAACCCACTCCCAACC
58 2 146
MUC2 F:GACGCACTGTATCATCAAACG
R:AGGATGGTCGTGTTGATGCG
58 2 409
CBE-1 F:GGTCAGAGCTTGAGGTAGCATGTG
R:GAGTTGTAACAGCACACTGCATTC
60 3 395
Tektin F:AGCTGGCTGATCATCTGGCCAAG
R:GGATTTCCTCATCTGCATACACAG
60 2 358