Skip to main content

Table 1 List of primers used for measuring gene expression by real time PCR

From: Impaired neonatal macrophage phagocytosis is not explained by overproduction of prostaglandin E2

Gene name Forward Primer Reverse Primer
β-actin CCTAAGGCCAACCGTGAAAA AGGGACAACACAGCCTGGAT
COX-1 GACCTGCCCCTATGTCTCCTT TCACGAAGACAGACCCGTCAT
COX-2 GGATCCCCAAGGCACAAATA CCTCGCTTCTGATCTGTCTTGA
5-LO GCTGCACAGAGTTGCCTAAGAA TCTAAACTGAGCTGCCGCTCTA
FLAP CCTTCGCTGGGCTGATGT TCTCCCAGATAGCCGACAAAGT
mPGEs-1 AGGGTGCCATGTTTTCAGAG CAGTCTTTGGAGGAGCCAAG
EP1 AGCAGATGTGAGGGCAGAGT GCCTCATCCACTAGGCTCAG
EP2 CCTGGCCATTATGACCATCAC TCGGGAAGAGGTTTCATCCA
EP3 GTCTAGGCTTGCTGGCTCTG TGCGTCTTGCATTGCTCTAC
EP4 ACGCGGGCTTCAGTTCCT CGCACACCAGCACATTGC
BLT1 AGGATGCAGAAACGCTCTGT CGGTCCAGGCTCATGATAGT
cys-LT 1 GCCTCACCACCTATGCCTTA CCTGTGGAGGGCTCAAAACAT
Fcγ receptor CCTGCAGAGTCCTGGCTTAC CTGATGACTGGGGACCAAAT