Skip to main content

Advertisement

Table 1 Primers used for qRT-PCR

From: Partial pulmonary embolization disrupts alveolarization in fetal sheep

Gene of
interest
Accession #,
Species
Region amplified
(nt#)
Primers 5'-3'
F: Forward
R: Reverse
Annealing
temp.
(°C)
VEGF-A AF071015.1,
Ovis aries
264-338 F: CGAAAGTCTGGAGTGTGTGC
R: TATGTGCTGGCTTTGGTGAG
60
Flk-1 AF534634,
Ovis aries
385-462 F: CCCAATCAGAGACCCACG
R: GCCATCCTGTTGAGCGTTA
60
PDGF-A NM_001075231.1,
Bos taurus
784-856 F: ATGGCGTGTTACATTCCTA
R: TTCACGGAGGAGAACAAAGA
59
PDGF-Rα XM_590921,
Bos taurus
213-276 F: GCAGGAGATCAGAGTGGAGA
R: TGAAAGCTGGCAGAGGATTA
59
18S X01117,
Rattus norvegicus
1495-1673 F: GTCTGTGATGCCCTTAGATGTC
R: AAGCTTATGACCCGCACTTAC
59-60
  1. nt# = nucleotide numbers, temp. = temperature.