Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 RT-PCR primers and products

From: A prostacyclin analogue, iloprost, protects from bleomycin-induced pulmonary fibrosis in mice

Genes S/AS Primer sequence (5' to 3') Products (bp)
CXCL10 S
AS
GTCATTTTCTGCCTCATCC
GAGCCCTTTTAGACCTTTT
273
IL-6 S
AS
TGGGACTGATGCTGGTGA
CTGGCTTTGTCTTTCTTGTTATC
376
TGFβ1 S
AS
CCCTGTATTCCGTCTCCTT
GCGGTGCTCGCTTTGTA
363
TNFα S
AS
GGCGGTGCCTATGTCTC
GCAGCCTTGTCCCTTGA
383
β-actin S
AS
CTTCCTTAATGTCACGCACGATTTC
GTGGGGCGGCCCAGGCACCA
541
  1. S, sense; AS, antisense