Skip to main content

Table 1 Primer sequences used for quantitative real time PCR amplification

From: Adaptive immunity to rhinoviruses: sex and age matter

Gene Name Forward (5' - 3') Reverse (3' - 5')
Ubiquitin containing enzyme E2D2 (UBE2D2) ATGGCAGCATTTGTCTTGATATTCTAC GGATTGGGATCACACAACAGA
Myxovirus protein A (MxA) CTCGGCAACAGACTCTTCCAT CATGAAGAACTGGATGATCAAAGG
2',5'-oligoadenylate synthetase (OAS) AGAAATACCCCAGCCAAATCTCT TGAGGAGCCACCCTTTACCA
Interleukin - 12 (IL-12)/p35 CCTTCACCACTCCCAAAACCT CCTCCACTGTGCTGGTTTTATCT
Interleukin-23 (IL-23)/p19 TGGGACACATGGATCTAAGAGAAG GAT CCT TTGCAAGCAGAACTGA