Skip to main content

Table 1 Table showing the sequences of designed and purchased rat primers and probes of MMPs investigated, the mRNA sequences used for the designs, and the conditions and optimised concentrations of each primer and probe.

From: MMP/TIMP expression profiles in distinct lung disease models: implications for possible future therapies

Assay PUBMED Assession No Assay Efficiency   Sequence
rat MMP-2 NM_031054 88.57% Assay on Demand Applied Biosystems | Rn01538174_m1
     GATTCTGCCCAGAGACTGCTATGTC
rat MMP-3 NM_133523 95.04% Forward Primer 5' CCT CTA TGG ACC TCC CAC AGA A 3'
    Probe 5' TAC CCA CCA AAT CTA ACT CTC TGG ACC CTG AG 3'
    Reverse Primer 5' CGA AGG ACA AAG CAG AGC TAC AC 3'
rat MMP-7 NM_012864 104.02% Forward Primer 5' CGG CGG AGA TGC TCA CTT T 3'
    Probe 5' ACA GGA AGT TCA CTC CTG AGT CCT CAC CAT C 3'
    Reverse Primer 5' GCC AAG TTC ATG AGT GGC AAC 3'
rat MMP-8 NM_022221 96.15% Assay on Demand Applied Biosystems | Rn00573646_m1
     GAAAACTGCTGAGAATTACCTACGA
rat MMP-9 NM_031055 99.79% Forward Primer 5' CCG AGA CCT GAA AAC CTC CAA 3'
    Probe 5' ACA CAC AGC TGG CAG AGG ATT ACC TGT ACC 3'
    Reverse Primer GCT GCC CGA GTG TAA CCA TAG 3'
rat MMP-10 NM_133514 94.89% Forward Primer 5' TCC TGG TGC TGC TGT GCT T 3'
    Probe 5' CCG ATC TGC TCA GCA TAT CCT CTG CAT 3'
    Reverse Primer 5' CTA GGT ATT GCT GAG CAA GAT CCA T 3'
rat MMP-11 NM_012980 95.63% Forward Primer 5' CCT GTG GAT GCA GCT TTT GAG 3'
    Probe 5' CCA GAT TTG GTT CTT CCA AGG TGC TCA GTA C 3'
    Reverse Primer 5' GGG CCT AGG ACT GGC TTC TC 3'
rat MMP-12 NM_053963 107.62% Assay on Applied Biosystems | Rn00588640_m1
    Demand TTCAAGGCACAAACCTGTTCCTTGT
rat MMP-13 XM_217083 98.34% Forward Primer 5' CCA GTC TCT CTA TGG TCC AGG AGA T 3'
    Probe 5' AGA CCC CAA CCC TAA GCA CCC CAA AAC 3'
    Reverse Primer 5' TCG GAG ACT AGT AAT GGC ATC AAG 3'
rat MMP-14 NM_031056 97.42% Forward Primer 5' CCG CCA TGC AAA GGT TCT A 3'
    Probe 5' CGA ATC GGC CTT GCC TGT CAC TTG 3'
    Reverse Primer 5' CGC CTC ATA GCC TTC ATC GT 3'
rat TIMP-1 NM_053819 96.22% Forward Primer 5' CCA CCT TAT ACC AGC GTT ATG AGA 3'
    Probe 5' CGT CGA ATC CTT TGA GCA TCT TAG TCA TCT TG 3'
    Reverse Primer 5' CCG GAA ACC TGT GGC ATT T 3'
rat TIMP-2 NM_021989 98.5% Forward Primer 5' GCT GGA CGT TGG AGG AAA GA 3'
    Probe 5' TCT CCT TCC GCC TTC CCT GCA ATT AGA TAT T 3'
    Reverse Primer 5' GCA CAA TAA AGT CAC AGA GGG TAA TG 3'
rat TIMP-3 NM_012886 100.27% Forward Primer 5' GAA CGG AAG CGT GCA CAT G 3'
    Probe 5' CCG ACA TCG TGA TCC GGG CC 3'
    Reverse Primer 5' CCC TTC CTT CAC CAG CTT CTT 3'
rat TIMP-4 NM_080639 97.27% Forward Primer 5' TGC AGA GGG AGA GCC TGA A 3'
    Probe 5' ACT GTG GCT GCC AAA TCA CCA CTT GC 3'
    Reverse Primer 5' GCC AGT CCG TCC AGA GAC A 3'