Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs

Gene GenBank Accession # Nucleotides amplified Upstream primer 5'-3' Downstream primer 5'-3'
EGR1 DQ239634 444–532 AGGGTCACTGTGGAAGGTC GCAGCTGAAGTCAAAGGAA
CTGF DQ239672 407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCA
CYR61 DQ239628 286–354 ATCGTCCAAACAACTTCGTG GGTAACGCGTGTGGAGATAC
IL-1β NM_001009465 353–473 CGATGAGCTTCTGTGTGATG CTGTGAGAGGAGGTGGAGAG
IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA
IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC
18S X01117 1495–1673 GTCTGTGATGCCCTTAGATGTC AAGCTTATGACCCGCACTTAC