Superoxide dismutase A antigens derived from molecular analysis of sarcoidosis granulomas elicit systemic Th-1 immune responses

  • Shannon S Allen1Email author,

    Affiliated with

    • Whitney Evans1Email author,

      Affiliated with

      • James Carlisle1,

        Affiliated with

        • Rana Hajizadeh1,

          Affiliated with

          • Michele Nadaf1,

            Affiliated with

            • Bryan E Shepherd2,

              Affiliated with

              • David T Pride3,

                Affiliated with

                • Joyce E Johnson4 and

                  Affiliated with

                  • Wonder P Drake1, 5Email author

                    Affiliated with

                    Respiratory Research20089:36

                    DOI: 10.1186/1465-9921-9-36

                    Received: 03 December 2007

                    Accepted: 25 April 2008

                    Published: 25 April 2008

                    Abstract

                    Background

                    Sarcoidosis is an idiopathic granulomatous disease with pathologic and immunologic features similar to tuberculosis. Routine histologic staining and culture fail to identify infectious agents. An alternative means for investigating a role of infectious agents in human pathogenesis involves molecular analysis of pathologic tissues for microbial nucleic acids, as well as recognition of microbial antigens by the host immune system. Molecular analysis for superoxide dismutase A (sodA) allows speciation of mycobacteria. SodA is an abundantly secreted virulence factor that generates cellular immune responses in infected hosts. The purpose of this study is to investigate if target antigens of the sarcoidosis immune response can be identified by molecular analysis of sarcoidosis granulomas.

                    Methods

                    We detected sodA amplicons in 12 of 17 sarcoidosis specimens, compared to 2 of 16 controls (p = 0.001, two-tailed Fisher's exact test), and 3 of 3 tuberculosis specimens (p = 0.54). Analysis of the amplicons revealed sequences identical to M. tuberculosis (MTB) complex, as well as sequences which were genetically divergent. Using peripheral blood mononuclear cells (PBMC) from 12 of the 17 sarcoidosis subjects, we performed enzyme-linked immunospot assay (ELISPOT) to assess for immune recognition of MTB sodA peptides, along with PBMC from 26 PPD- healthy volunteers, and 11 latent tuberculosis subjects.

                    Results

                    Six of 12 sarcoidosis subjects recognized the sodA peptides, compared to one of 26 PPD- controls (p = 0.002), and 6/11 PPD+ subjects (p = .68). Overall, 10 of the 12 sarcoidosis subjects from whom we obtained PBMC and archival tissue possessed molecular or immunologic evidence for sodA.

                    Conclusion

                    Dual molecular and immunologic analysis increases the ability to find infectious antigens. The detection of Th-1 immune responses to sodA peptides derived from molecular analysis of sarcoidosis granulomas reveals that these are among the target antigens contributing to sarcoidosis granulomatous inflammation.

                    Background

                    Sarcoidosis is a disease of unknown etiology, characterized pathologically by noncaseating granulomas that most commonly involve the lung, skin, lymph nodes and eyes [1]. Syndromes with similar pathologic and immunologic features to sarcoidosis such as chronic beryllium disease [2], hypersensitivity pneumonitis [3], and tuberculosis [4] indicate that granulomatous diseases may or may not have an infectious etiology. Recently, several reports from independent laboratories have associated mycobacteria with sarcoidosis immunopathogenesis. One report of molecular analysis of sarcoidosis granulomas revealed the presence of multiple mycobacterial genes [5]. Humoral immune responses to Mycobacterium katG and heat shock proteins by sarcoidosis subjects [6, 7] as well as the detection of these proteins in sarcoidosis granulomas have been reported [6, 8]. Most recently, a report of Th-1 immune responses to mycobacterial antigens from sarcoidosis subjects added further support to the hypothesis that mycobacterial antigens may have a role in sarcoidosis pathogenesis [9].

                    Superoxide dismutase A (sodA) is a virulence factor secreted in large quantities by pathogenic Mycobacterium and Nocardia species, converting oxygen free radicals generated by host macrophages to hydrogen peroxide [10]. M. tuberculosis encodes two superoxide dismutases (SOD), an iron-cofactored enzyme (sodA) and a copper-zinc enzyme (sodC) [11]. Strong immune responses are elicited against sodA in tuberculosis-infected mice [12]. Molecular analysis of the sodA gene identifies Mycobacterium species [13]. The purpose of this study is to assess if molecular analysis of sarcoidosis granulomas will reveal microbial virulence factors which can induce Th-1 immune responses in the same subjects. Taking advantage of the capability of molecular analysis of sodA to identify Mycobacterium species, as well as the ability of sodA to generate strong immune responses, we conducted molecular analysis for the presence of Mycobacterium sodA in sarcoidosis granulomas, followed by immunologic assessment for Th-1 immune responses to sodA peptides in the same sarcoidosis subjects.

                    Methods

                    Recruitment of study participants

                    This study was approved by the Vanderbilt University Institutional Review Board for human studies, and informed written consent was obtained from the study participant or their surrogates, if required. All sarcoidosis subjects from the available patient database of the Vanderbilt University Pulmonary Clinic or members of the Middle Tennessee Sarcoidosis Support Group were invited to participate in the study. For inclusion in this study, the following criteria were used for patients with sarcoidosis: 1) clinical features of acute respiratory illness accompanied by erythema nodosum, hilar adenopathy and arthritis [Lofgren's syndrome], or indolent progressive pulmonary decompensation associated with radiographic findings, such as hilar adenopathy, reticulonodular infiltrates, or pulmonary fibrosis); 2) histopathologic features had confluent noncaseating granulomas, well circumscribed within the surrounding tissue with a variable amount of peripheral lymphocytic infiltration [4]); 3) known microbial causes for granulomata had to be excluded (i.e., specimens were negative for microorganisms by hematoxylin and eosin (H&E), fungal, acid fast bacilli (AFB), and auramine-O stains and on routine bacterial, fungal, and AFB cultures). Frozen or paraffin-embedded archival specimens from 21 sarcoidosis subjects were obtained; four were excluded due to the lack of granulomatous involvement on the slide or pathology inconsistent with the diagnosis of sarcoidosis, which left 17 specimens for molecular analysis. Nineteen frozen or paraffin-embedded control specimens were obtained from the archives of Vanderbilt Pathology Department, or the Cooperative Human Tissue Network: three tuberculosis specimens and 16 negative control specimens of infectious and non-infectious etiologies. All sarcoidosis and control specimens had their diagnostic slides independently confirmed by a pathologist.

                    For the enzyme-linked immunospot assay (ELISPOT), we were able to collect blood on 12 of the 17 sarcoidosis subjects. Due to the Health Insurance Portability and Accountability Act of 1996 (HIPAA) regulations, we could not contact the negative or positive control subjects of whom we had archival tissues. We invited 26 PPD negative (PPD-) healthy volunteers to participate as negative controls for the ELISPOT analysis. The PPD- volunteers had undergone PPD testing by the Vanderbilt employee health services. Subjects with latent tuberculosis (PPD+) were invited as positive controls, and had written documentation of their PPD status with no evidence of active disease at the time of study enrollment. Approximately 60% of the sarcoidosis, PPD- and PPD+ subjects had participated in a previous investigation of immune responses to mycobacterial antigens [14].

                    DNA extraction of archival tissue

                    For each sarcoidosis and control specimen, the original paraffin-embedded tissue block was retrieved from the archives if available. From each block, we cut a single 5 μm section that was stained with H&E to confirm the pathology and demarcate areas of granulomatous involvement; another ten 10 μm sections were cut, three of which were used for extraction of DNA, and the remaining seven sections were stored for future analysis. The specimens were randomly processed for slide preparation. For each section from patients with sarcoidosis and for the control specimens, granulomata were macrodissected and extracted with disposable surgical blades. For the control specimens without granulomata, all tissue from three 10 μm sections was used for DNA extraction.

                    For the frozen specimens, 25 mg of frozen sarcoidosis or control specimens were initially minced with sterile disposable surgical blades prior to overnight proteinase K digestion. For all specimens, DNA was extracted with the QIAGEN DNAeasy extraction kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions, with the exception of the following changes: 1) 60 μL of proteinase K was used at a concentration of 20 mg/mL; 2) after the overnight digestion, 0.5 mm glass beads (Biospec Products, Inc., Bartlesville, OK) were added to the completely digested tissue, which was subsequently vortexed for 45 seconds; 3) the DNA was eluted with 100 μL of Buffer AE, instead of 200 μL.

                    Tissue dissection and DNA preparation were performed in a dedicated clean room, which was separate from the rooms used for PCR analysis and sequencing. The extracted DNA was stored at -80°C. Groups of tissue specimens from patients with sarcoidosis, tuberculosis, and controls were processed in parallel during all steps of the procedure, including extraction of the DNA, amplification and detection of mycobacterial DNA, and sequence analysis. The clinical diagnosis of each specimen was blinded throughout the entire analysis.

                    Real-time PCR and sequence analysis

                    Six overlapping primer sets that cover the entire ORF for Mycobacterium tuberculosis complex sodA (GenBank No. AF061030) were designed using Primer Express software (Applied Biosystems Inc., Foster City, CA) and are described in Table 1. Real-time PCR, performed with SYBR Green I double-stranded binding dye (Applied Biosystems), and dissociation curve analysis were carried out according to the manufacturer's protocol on the ABI Prism 7000 Sequence Detection System. The quality of DNA extracted from each clinical specimen was assessed by screening for human beta actin, using the primers F 5'-ACCGAGCGCGGCTACAG-3' and R 5'-CTTAATGTCACGCACGATTTCC-3'. Human beta actin was amplified from all 36 clinical specimens. For each analysis, two microliters of MTB H37Rv genomic DNA (Colorado State University), corresponding to ~104 genomic copies, was used as the positive control, five microliters of irradiated water as the negative control, and five microliters of template DNA from each clinical specimen. Samples whose dissociation curve peaks had a melting temperature within 1°C of TB DNA were selected for further analysis on a 3% TBE gel. Bands that electrophoresed within approximately 10 bp of TB DNA were excised and purified using the QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia CA). Both strands of the DNA were directly sequenced by GenePass, Inc (Nashville, TN). Only sequences verified from the positive and negative strand of the amplicon were used for analysis. Alignments of sodA sequences from sarcoidosis patients were performed using the NCBI BLAST program.
                    Table 1

                    Sequences of primers used to amplify sodAa

                    Name

                     

                    Primer sequence

                    Amplicon length (bp)

                    Nucleotide (ORF)/amino acid position

                    Region 1

                    Fb

                    5' CCGTGGCCGAATACACCTT 3'

                    127

                    -167

                     

                    R

                    5' CATTGGCGCCCTTTACGTA 3'

                      

                    Region 2

                    F

                    5' GAGCTTCACCACAGCAAGCA 3'

                    127

                    76–202/26–67

                     

                    R

                    5' AAGCTAGATTCTTTTCGTTCAGCAA 3'

                      

                    Region 3

                    F

                    5' CGTCGCCAAACTCGAAGAG 3'

                    151

                    129–279/44–93

                     

                    R

                    5' GCCGGTGGGCTTGTCA 3'

                      

                    Region 4

                    F

                    5' GCCACGTCAATCACACCATCT 3'

                    232

                    215–446/73–149

                     

                    R

                    5' AAGTTCGTCTGGTGGTCGTAAAC 3'

                      

                    Region 5

                    F

                    5' GGGACACACTCGGCAACAA 3'

                    158

                    389–546/131–182

                     

                    R

                    5' CAAAACGCCTTGGCAAAGTC 3'

                      

                    Region 6

                    F

                    5' TTTACGACCACCAGACGAACTTC 3'

                    161

                    425–585/150–195

                     

                    R

                    5' CGCATACCGTGACTGCACAT 3'

                      

                    aBased on M. tuberculosis H37Rv sodA sequence (GenBank no. AF061030)

                    bF – forward, R – reverse

                    Phylogenetic analysis and sequence alignments

                    Sequences of sodA from various Mycobacterium species were obtained from GenBank. Because there is no genetic variability of sodA among members of MTB complex; sequence alignment was based upon GenBank no. AF061030. In addition to MTB complex and sarcoidosis amplicons, multiple corresponding nucleotide sequence alignments of sodA region 4 (base pairs 215–446, GenBank no. AF061030) from pathogenic and nonpathogenic mycobacteria were created using ClustalX. Phylograms of nucleotide alignments were generated using the Paup 4.0b10 neighbor-joining method, based on HKY85 distances. The resulting phylograms were displayed using midpoint rooting.

                    Preparation of peripheral blood mononuclear cells (PBMC)

                    PBMC were isolated from blood drawn into tubes containing EDTA, and separated by Ficoll-Hypaque density gradient separation (Amersham Biosciences) according to the manufacturer's instructions. The PBMC were cryopreserved in fetal calf serum with 10% dimethy sulfoxide (DMSO), and stored in liquid nitrogen until time for analysis.

                    Synthesis of mycobacterial peptides

                    Forty sodA peptides, 15-mers overlapping by 10, which span the entire amino acid sequence of MTB superoxide dismutase (GenBank no. AAD15824.1) were generated (Table 2). Each sodA peptide was synthesized by solid-phase F-moc chemistry (Genemed Synthesis, San Diego, CA), to a purity of >70%.
                    Table 2

                    SodA peptide sequences used in immune recognition assays

                    Peptide

                    Position

                    Peptide sequence

                    Peptide

                    Position

                    Peptide sequence

                    1

                    1–15

                    VAEYTLPDLDWDYGA

                    21

                    101–115

                    DAFGSFDKFRAQFHA

                    2

                    6–20

                    LPDLDWDYGALEPHI

                    22

                    106–120

                    FDKFRAQFHAAAT TV

                    3

                    11–25

                    WDYGALEPHISGQIN

                    23

                    111–125

                    AQFHAAAT TVQGSGW

                    4

                    16–30

                    LEPHISGQINELHHS

                    24

                    116–130

                    AAT TVQGSGWAALGW

                    5

                    21–35

                    SGQINELHHSKHHAT

                    25

                    121–135

                    QGSGWAALGWDTLGN

                    6

                    26–40

                    ELHHSKHHATYVKGA

                    26

                    126–140

                    AALGWDTLGNKLLIF

                    7

                    31–45

                    KHHATYVKGANDAVA

                    27

                    131–145

                    DTLGNKLLIFQVYDH

                    8

                    36–50

                    YVKGANDAVAKLEEA

                    28

                    136–150

                    KLLIFQVYDHQTNFP

                    9

                    41–55

                    NDAVAKLEEARAKED

                    29

                    141–155

                    QVYDHQTNFPLGIVP

                    10

                    46–60

                    KLEEARAKEDHSAIL

                    30

                    146–160

                    QTNFPLGIVPLLLLD

                    11

                    51–65

                    RAKEDHSAILLNEKN

                    31

                    151–165

                    LGIVPLLLLDMWEHA

                    12

                    56–70

                    HSAILLNEKNLAFNL

                    32

                    156–170

                    LLLLDMWEHAFYLQY

                    13

                    61–75

                    LNEKNLAFNLAGHVN

                    33

                    161–175

                    MWEHAFYLQYKNVKV

                    14

                    66–80

                    LAFNLAGHVNHT IWW

                    34

                    166–180

                    FYLQYKNVKVDFAKA

                    15

                    71–85

                    AGHVNHT IWWKNLSP

                    35

                    171–185

                    KNVKVDFAKAFWNVV

                    16

                    76–90

                    HT IWWKNLSPNGGDK

                    36

                    176–190

                    DFAKAFWNVVNWADV

                    17

                    81–95

                    KNLSPNGGDKPTGEL

                    37

                    181–195

                    FWNVVNWADVQSRYA

                    18

                    86–100

                    NGGDKPTGELAAAIA

                    38

                    186–200

                    NWADVQSRYAAATSQ

                    19

                    91–105

                    PTGELAAAIADAFGS

                    39

                    191–205

                    QSRYAAATSQTKGLI

                    20

                    96–110

                    AAAIADAFGSFDKFR

                    40

                    193–207

                    RYAAATSQ TKGLIFG

                    ELISPOT analysis for interferon gamma production

                    ELISPOT assays were performed as previously described [15]. Briefly 96-well polyvinylidene difluoride-backed plates were coated with anti-interferon-γ [IFN-γ] mAb, 1-DIK (0.5 μg/ml; Mabtech, Stockhlm, Sweden) at 4°C overnight. The following day, PBMC were added directly at 105 cells/well in R10 media (RPMI-1640 supplemented with 2 mM L-glutamine, 50 IU/ml penicillin, 50 μg/ml streptomycin, and 10% heat inactivated FBS (Invitrogen Corporation, Irvine, CA) and then sodA peptides were added to individual wells in duplicate (20 μg/ml final concentration). Phytohemagluttin A (PHA) or media alone served as positive and negative controls, respectively. The plates were incubated for 18 hours at 37°C in 5% CO2. After washing six times with phosphate buffered saline (PBS) plates were incubated for 2 hours with biotinylated anti-IFN-γ mAb, 7-B6-1 (0.5 μg/ml; Mabtech). After additional washes, a 1:2,000 dilution of streptavidin-alkaline phosphatase conjugate was added to each well for 2 hours. The plates were then washed, and IFN-γ producing cells detected after a 10–20 min color reaction using chromogenic alkaline phosphatase substrate (BCIP/NBT Substrate Kit, Vector Laboratories). Interferon gamma (IFN-γ) producing cells were counted using an IMMUNOSPOT 3 Analyzer (Cellular Technology Limited (C.T.L); Cleveland, OH). Results were expressed as the number of spot-forming cells (SFC) per 106 PBMC. The mean number of spots in duplicate negative control wells was less than two for all 26 PPD- participants. A positive response was defined as at least 50 SFC/106 PBMC, and at least three times above background. The definition of a positive result was based upon a prior analysis, involving recognition of ESAT-6 and katG in systemic sarcoidosis [9]. Assays using PBMC from PPD-, PPD+ and sarcoidosis subjects were performed simultaneously; the technicians were blinded to the clinical diagnosis of each study participant throughout the analysis.

                    Statistical Analysis

                    Comparisons of the distribution of T cell frequencies were performed using the Wilcoxon rank sum test. Categorical comparisons, such as the percentage of individuals with immune reactivity to mycobacterial antigens, were made using Fisher's exact test. All performed comparisons are reported, all p-values are 2-sided, and all analyses were performed using R (Version 2.1.1).

                    Results

                    Clinical characteristics of study participants

                    Of the 17 sarcoidosis subjects, 5(29%) were African-American, 9(53%) were male, and 16(94%) were ≤ 50 years of age (Table 3). Biopsies were taken from lung, lymph node, or skin. Of the 16 control subjects, 1(6%) was African-American, 9(56%) were male, and 11(69%) were ≤ 50 years of age. Biopsies were taken from lung, lymph node, skin or colon. Of the three tuberculosis patients, one was African-American, all were male and <50 years of age (Table 3). Biopsies were taken from lymph node in two patients, and the meniscus of the knee of the third patient. Acid-fast bacilli (AFB) were highly visible in two specimens (TB 1 and 3) and rare in one specimen (TB 2); M. tuberculosis was cultured from all three. Granulomatous involvement was noted in all 17 sarcoidosis specimens, 10 of 16 control specimens, and all three tuberculosis specimens (Table 3). Ten of the 17 sarcoidosis subjects had undergone tuberculin skin testing at the discretion of their primary physician; all ten were negative, as were all of the PPD- healthy volunteers. The status of the remaining seven is unknown.
                    Table 3

                    Molecular analysis for sodA among sarcoidosis and control specimens

                    Patient

                    Age, Sex, Racea

                    Biopsy site

                    Pathologic diagnosis

                    Presence of granuloma

                    Tissue storageb

                    PCR analysisc

                    sodA region(s)

                    Sarcoid 1

                    31, M, C

                    Lung

                    Sarcoidosis

                    Yes

                    Frozen

                    Mtb complex

                    4, 5

                    Sarcoid 2

                    46, F, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    Frozen

                    GDM

                    4

                    Sarcoid 3

                    65, M, U

                    Lymph node

                    Sarcoidosis

                    Yes

                    Frozen

                    Mtb complex

                    2, 4

                    Sarcoid 4

                    29, F, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    -

                    -

                    Sarcoid 5

                    36, F, AA

                    Lung

                    Sarcoidosis

                    Yes

                    Frozen

                    Mtb complex

                    4

                    Sarcoid 6

                    48, F, AA

                    Skin

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    3

                    Sarcoid 7

                    30, M, AA

                    Skin

                    Sarcoidosis

                    Yes

                    Frozen

                    Mtb complex

                    5

                    Sarcoid 8

                    33, F, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    4

                    Sarcoid 9

                    50, F, AA

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    -

                    -

                    Sarcoid 10

                    50, M, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    5

                    Sarcoid 11

                    41, F, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    -

                    -

                    Sarcoid 12

                    39, M, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    -

                    -

                    Sarcoid 13

                    46, M, AA

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    5

                    Sarcoid 14

                    45, M, C

                    Skin

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    2

                    Sarcoid 15

                    34, F, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    GDM

                    4

                    Sarcoid 16

                    28, M, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    Frozen

                    -

                    -

                    Sarcoid 17

                    34, M, C

                    Lymph node

                    Sarcoidosis

                    Yes

                    FFPE

                    Mtb complex

                    2

                    Control 1

                    70, F, C

                    Colon

                    Normal colon

                    No

                    Frozen

                    -

                    -

                    Control 2

                    22, F, C

                    Lymph node

                    Histoplasmosis

                    Yes

                    Frozen

                    Mtb complex

                    4, 5

                    Control 3

                    60, M, C

                    Lymph node

                    Nocardia

                    Yes

                    Frozen

                    -

                    -

                    Control 4

                    56, F, C

                    Lymph node

                    Cholangial carcinoma

                    No

                    Frozen

                    -

                    -

                    Control 5

                    49, M, C

                    Lymph node

                    Nonspecific Interstitial Pneumonia

                    No

                    Frozen

                    -

                    -

                    Control 6

                    11, F, AA

                    Skin

                    Blastomycosis

                    Yes

                    FFPE

                    -

                    -

                    Control 7

                    51, F, C

                    Lung

                    Histoplasmosis

                    Yes

                    FFPE

                    -

                    -

                    Control 8

                    26, M, C

                    Lung

                    Histoplasmosis

                    Yes

                    FFPE

                    -

                    -

                    Control 9

                    30, M, C

                    Lung

                    Blastomycosis

                    Yes

                    FFPE

                    -

                    -

                    Control 10

                    25, M, C

                    Skin

                    Blastomycosis

                    Yes

                    FFPE

                    -

                    -

                    Control 11

                    26, M, C

                    Skin

                    Blastomycosis

                    Yes

                    FFPE

                    -

                    -

                    Control 12

                    36, M, U

                    Lung

                    Hodgkin's lymphoma

                    No

                    Frozen

                    -

                    -

                    Control 13

                    15, M, U

                    Lymph node

                    Hodgkin's lymphoma

                    No

                    Frozen

                    -

                    -

                    Control 14

                    68, M, C

                    Lymph node

                    Sinus histiocytosis

                    No

                    Frozen

                    -

                    -

                    Control 15

                    47, F, C

                    Lymph node

                    Histoplasmosis

                    Yes

                    FFPE

                    -

                    -

                    Control 16

                    35, F, C

                    Lung

                    Cryptococcus

                    Yes

                    FFPE

                    Mtb complex

                    4

                    TB 1

                    30, M, C

                    Lymph node

                    Tuberculosis

                    Yes

                    FFPE

                    Mtb complex

                    3, 5

                    TB 2

                    46, M, C

                    Knee

                    Tuberculosis

                    Yes

                    FFPE

                    Mtb complex

                    2, 4, 5

                    TB 3

                    36, M, H

                    Lymph node

                    Tuberculosis/AIDS

                    Yes

                    FFPE

                    Mtb complex

                    1 – 6

                    aC-Caucasian, AA-African American, H-Hispanic, U-Unknown; bFFPE – formalin-fixed, paraffin-embedded cGDM – genetically distinct mycobacteria

                    Sequences consistent with MTB complex sodA were amplified from sarcoidosis granulomas

                    Multiple regions of sodA were amplified from all three tuberculosis patients (Table 3). The number of regions that we were able to amplify correlated with the number of bacilli seen on histologic staining (Table 3). For example, we amplified all six regions of MTB complex sodA from TB 3, a lymph node from an AIDS patient, containing numerous AFB. In contrast, we amplified only three regions from TB 2, a knee specimen, which possessed only rare AFB on histologic stain. Each sarcoidosis sample was AFB negative, and we generally amplified a single region of sodA, compared to multiple ones. Due to the small number of TB specimens tested, it is difficult to determine a true correlation of amplication cycle and detection of mycobacteria by AFB histologic staining. The true correlation will require testing additional MTB specimens.

                    SodA amplicons were detected in 12 of 17 sarcoidosis specimens, compared to two of 16 negative control specimens (p = 0.001) (Table 3). The sarcoidosis amplicons spanned regions 2–5; regions 1 and 6 were not amplified from any of the sarcoidosis specimens. Six specimens were positive for region 4 and four for region 5. In Sarcoid 1, amplicons from regions 4 and 5 were detected, resulting in a segment of sodA that was 276 bp long (GenBank accession no. DQ822576); in Sarcoid 3, regions 2 and 4 were detected. Sequence analysis of the amplicons from 10 specimens revealed 100% positional identity with MTB complex. The primers of regions 1 and 4 were capable of amplifying sodA nucleic acids from nontuberculosis mycobacteria, such as M. kansasii (personal observation). However, only sequences consistent with MTB complex were detected. In two specimens (Sarcoid 2 and 15), the amplicons from region 4 contained 99% positional identity with MTB complex. The same polymorphism, A302G, was detected in both specimens (GenBank accession no. DQ768096), despite these samples being processed and analyzed three months apart. This nucleotide substitution resulted in a D101G mutation (GenBank accession no. ABG68026) in a previously published amino acid sequence for MTB sodA (GenBank accession no. AAD15824.1) (Figure 1A). Phylogenetic analysis of the unique sarcoidosis sodA sequences at position 215–446 based upon GenBank No. AF061030 (Region 4) distinguished them from other members of MTB complex (Figure 1B).
                    http://static-content.springer.com/image/art%3A10.1186%2F1465-9921-9-36/MediaObjects/12931_2007_667_Fig1_HTML.jpg
                    Figure 1

                    Comparison of sodA amplicons generated from sarcoidosis granulomas toM. tuberculosissodA. PCR analysis for sodA nucleic acids in sarcoidosis granulomas revealed amplicons with 100% positional identity with M. tuberculosis complex (MTB) among 10 of 12 sarcoidosis specimens, represented by Sarcoidosis 3. Region 4 of Sarcoid 2 contained the same nucleotide substitution as Sarcoid 15 (A302G), resulting in the amino acid substitution D101G (Figure 1A). The two sarcoidosis samples were processed three months apart. Phylogenetic analysis of the amplicons placed all the sequences as most consistent with members of MTB complex, but noted that the sequences detected in Sarcoid 2 and 15 were distinct from other members, including the 10 sarcoidosis samples (Figure 1B).

                    It has been reported that environmental mycobacteria preferentially localize to established tuberculous granulomas [16]. In order to determine if the detection of mycobacterial sodA in sarcoidosis granulomas reflected preferential localization of mycobacteria to granulomatous inflammation, we analyzed granulomatous controls of known etiology. Despite extracting and analyzing sarcoidosis and controls specimens simultaneously, sodA nucleic acids were absent in all but 2 control patients, Controls 2 and 16. MTB complex sodA amplicons were detected in these two specimens, although they were negative for mycobacteria by both histology and culture. In Control 2, sodA amplicons were detected for regions 4 and 5, while only region 4 was amplified from Control 16. There was a significant difference for the detection of sodA nucleic acids among the granulomatous sarcoidosis specimens (12 of 17), in comparison to the granulomatous negative controls (2 of 10) (p = 0.018) (Table 3).

                    Frozen and paraffin-embedded specimens sarcoidosis and control specimens were included to determine whether mycobacteria were introduced during tissue fixation. There was not a significant difference in the presence of sodA nucleic acids among the sarcoidosis specimens that were frozen in comparison to those that were formalin-fixed, paraffin-embedded (5/6 versus 7/11, p = 0.6) (Table 3).

                    Immune recognition of sodA is distinct between sarcoidosis and PPD- healthy volunteers

                    Several reports have demonstrated the presence of cellular immune responses to mycobacterial antigens among patients infected with MTB [12, 17]. Because analysis of the sarcoidosis amplicons were most consistent with MTB complex sodA, we generated 40 peptides that cumulatively span the entire MTB sodA protein (GenBank no. AAD15824.1), and stimulated PBMC from a subgroup of sarcoidosis, PPD- and PPD+ subjects to identify immunogenic peptides. There was no recognition of any of the 40 sodA peptides among the PPD- control subjects. Among the sarcoidosis and PPD+ subjects, four of the 40 peptides were recognized most frequently: sodA 31, 33, 36 and 38 (Table 2). PBMC from all 49 subjects were tested against these four peptides; peptides before or after peptides 31, 33, 36 and 38 were also tested if PBMC were available.

                    Of the 17 sarcoidosis subjects from whom we obtained archival tissues for molecular analysis, we were able to obtain PBMC from 12. The clinical characteristics of the sarcoidosis subjects were detailed earlier. Because the biopsy and PBMC were not obtained simultaneously, there was variation in the age of the sarcoidosis subjects (Table 3 and 4 reflects the subject's age at acquisition of tissue or PBMC, respectively). In addition to these 12 subjects, we obtained PBMC from 26 PPD- healthy volunteers, and 11 subjects with PPD+. Of the 26 PPD- patients, 14(54%) were African American, 6(23%) were male and 20(77%) ≤ 50 years of age (Table 4). Of the 11 PPD+ subjects, 4(36%) were African American, 3(27%) male, and 8(73%) ≤ 50 years of age (Table 4).
                    Table 4

                    Immune recognition to sodA peptides among study participants

                    Subject

                    Agea/Sexb/Racec

                    Site of Involvementd

                    sodA*

                    Subject

                    Agea/Raceb/Sexc

                    Site of Involvementd

                    sodA*

                    Sarcoidosis 6

                    50, F, AA

                    P, C

                    70

                    Control 1

                    43, F, AA

                    None

                    0

                    Sarcoidosis 7

                    31, M, AA

                    CNS, P, C

                    150

                    Control 2

                    38, F, C

                    None

                    0

                    Sarcoidosis 8

                    34, F, C

                    P

                    100

                    Control 3

                    27, F, AA

                    None

                    10

                    Sarcoidosis 9

                    55, F, AA

                    P

                    65

                    Control 4

                    33, F, AA

                    None

                    0

                    Sarcoidosis 10

                    56, M, C

                    P

                    0

                    Control 5

                    23, M, C

                    None

                    0

                    Sarcoidosis 11

                    47, F, C

                    P, CNS

                    0

                    Control 6

                    25, F, C

                    None

                    0

                    Sarcoidosis 12

                    42, M, C

                    P

                    0

                    Control 7

                    31, M, AA

                    None

                    0

                    Sarcoidosis 13

                    51, M, AA

                    P

                    110

                    Control 8

                    52, F, C

                    None

                    0

                    Sarcoidosis 14

                    45, M, C

                    P, C

                    0

                    Control 9

                    32, F, C

                    None

                    0

                    Sarcoidosis 15

                    34, F, C

                    P

                    0

                    Control 10

                    34, F, AA

                    None

                    0

                    Sarcoidosis 16

                    30, M, C

                    P

                    160

                    Control 11

                    29, M, C

                    None

                    0

                    Sarcoidosis 17

                    33, M, C

                    P

                    0

                    Control 12

                    52, F, C

                    None

                    0

                        

                    Control 13

                    35, F, C

                    None

                    0

                        

                    Control 14

                    57, F, C

                    None

                    0

                        

                    Control 15

                    54, F, C

                    None

                    0

                    PPD+ 1

                    49, F, C

                    Latent

                    360

                    Control 16

                    57, F, C

                    None

                    10

                    PPD+ 2

                    50, F, AA

                    Latent

                    50

                    Control 17

                    55, F, AA

                    None

                    0

                    PPD+ 3

                    42, F, AA

                    Latent

                    100

                    Control 18

                    37, M, AA

                    None

                    0

                    PPD+ 4

                    58, M, AA

                    Latent

                    65

                    Control 19

                    44, F, C

                    None

                    0

                    PPD+ 5

                    50, F, C

                    Latent

                    50

                    Control 20

                    32, F, AA

                    None

                    0

                    PPD+ 6

                    60, F, AA

                    Latent

                    0

                    Control 21

                    32, F, AA

                    None

                    500

                    PPD+ 7

                    38, F, C

                    Latent

                    0

                    Control 22

                    27, F, AA

                    None

                    0

                    PPD+ 8

                    49, F, C

                    Latent

                    0

                    Control 23

                    42, F, AA

                    None

                    0

                    PPD+ 9

                    42, M, AA

                    Latent

                    55

                    Control 24

                    32, M, AA

                    None

                    0

                    PPD+ 10

                    51, F, C

                    Latent

                    0

                    Control 25

                    26, F, AA

                    None

                    0

                    PPD+ 11

                    30, M, C

                    Latent

                    0

                    Control 26

                    50, M, AA

                    None

                    0

                    aAge in years; bAA, African-American; C, Caucasian; cF, female, M, male; d P, Pulmonary; C, Cutaneous; CNS, Central Nervous System; ABD, Abdominal; *Inteferon-γ producing spot-forming cells per million PBMC

                    Using the ELISPOT assay, we detected immune recognition of sodA peptides among six of 12 sarcoidosis subjects, compared to one of the 26 PPD- controls (p = 0.002), and six of 11 subjects with PPD+ infection (p = 1.0) (Table 4). We performed multivariable logistic regression analysis to assess if factors such as sex, race, or site of involvement affected recognition of sodA. There was no significant association with either of these factors, although there was a trend toward significance in regards to race. For example, 4/4 African-Americans (AA) with sarcoidosis recognized sodA using ELISPOT, compared to 2/8 Caucasians (p = 0.06); 4/5 PPD+ AA recognized sodA compared to 2/6 Caucasians (p = 0.24); and 1/14 PPD- control AA recognized sodA compared to 0/12 Caucasians (p = 1.0). Although none of these comparisons are statistically significant, this could be due to low power. In fact, we performed multivariable logistic regression, adjusting for race (AA or non-AA) and group (PPD- control, sarcoidosis, or PPD+), and AA race was significantly associated with increased recognition (p = 0.01). However, after adjusting for race, sarcoidosis and PPD+ participants were still more likely to recognize sodA than PPD- controls (p = 0.002 and 0.01, respectively), consistent with the unadjusted analyses.

                    Despite negative culture and histology for mycobacterial infection in sarcoidosis specimens, there was a significant difference in recognition of sodA peptides between the sarcoidosis and PPD- healthy volunteers, but not between sarcoidosis and PPD+ subjects. We also assessed the distribution of the T cell frequencies among the PPD-, sarcoidosis and PPD+ subjects. There was a significant difference between the sarcoidosis and PPD- subjects (p = 0.002, Wilcoxon), but again, not between the sarcoidosis and PPD+ subjects (p = 0.72) (Figure 2). Three sarcoidosis subjects recognized two or more sodA peptides, demonstrating that multiple sodA epitopes generate a Th-1 immune response (Figure 3).
                    http://static-content.springer.com/image/art%3A10.1186%2F1465-9921-9-36/MediaObjects/12931_2007_667_Fig2_HTML.jpg
                    Figure 2

                    Distribution of T cell frequencies among PPD negative, sarcoidosis and PPD+ subjects. The horizontal bars represent the 25th, 50th and 75th percentile respectively. There was a lack of recognition of sodA peptides among the majority of the PPD- control group, and a significant difference overall among the three groups. Among the sarcoidosis subjects, the distribution of the T cell frequencies among the sarcoidosis subjects more closely paralleled that of the PPD positive subjects also, rather than the PPD negative healthy volunteers.

                    http://static-content.springer.com/image/art%3A10.1186%2F1465-9921-9-36/MediaObjects/12931_2007_667_Fig3_HTML.jpg
                    Figure 3

                    Recognition of multiple sodA peptides among individual sarcoidosis subjects. Peptide screening identified peptides toward the terminal end of sodA as being immunogenic. Among the sarcoidosis subjects who recognized sodA, recognition of more than one peptide was frequently observed. Peptides 36 and 38 were frequently immunogenic, although there was variation in the magnitude of the response generated by each subject. Numerous sodA peptides were recognized by PPD+ subjects. A representative analysis of the PPD+ subjects is included. The recognition of multiple sodA peptides by the sarcoidosis subjects suggests that the sarcoidosis Th-1 immune response may be elicited by multiple antigenic peptides rather than a single dominant antigen.

                    The majority of sarcoidosis subjects have molecular or immunologic evidence of Mycobacterium sodA

                    Prior PCR analysis and immune recognition assays for the presence of sodA was significantly distinct between the sarcoidosis and PPD- control subjects. We were interested in the number of sarcoidosis subjects possessing molecular or immunologic evidence for sodA. There were 12 sarcoidosis subjects of whom we obtained archival tissue and blood. Eight of the 12 were positive by PCR analysis, and six positive by the ELISPOT assay. Four subjects (Sarcoid 6–8, 13) were positive for sodA nucleic acids, as well as recognition of sodA peptides; Sarcoid 11 and 12 were negative by both assays (Table 5). In total among the 12 specimens, 10 were positive by PCR or by ELISPOT analysis and 50% of the specimens had molecular and immunologic agreement for the presence or absence of sodA (Table 5).
                    Table 5

                    Comparison of molecular and immunologic analysis for the detection of sodA.

                     

                    PCR

                    ELISPOT

                    Sarcoid 6

                    +

                    +

                    Sarcoid 7

                    +

                    +

                    Sarcoid 8

                    +

                    +

                    Sarcoid 9

                    -

                    +

                    Sarcoid 10

                    +

                    -

                    Sarcoid 11

                    -

                    -

                    Sarcoid 12

                    -

                    -

                    Sarcoid 13

                    +

                    +

                    Sarcoid 14

                    +

                    -

                    Sarcoid 15

                    +

                    -

                    Sarcoid 16

                    -

                    +

                    Sarcoid 17

                    +

                    -

                    +, positive analysis for sodA; -, negative analysis for sodA

                    Discussion

                    The absence of histologic and microbiologic evidence of microorganisms in the sarcoidosis granulomas has led to questions about a role for infectious agents in sarcoidosis immunopathogenesis. This report describes molecular and immunologic support for the presence of the virulence factor, Mycobacterium sodA, in systemic sarcoidosis.

                    The strength of molecular analysis for sodA lies in the ability to identify pathogenic Mycobacterium species [13]. The detection of sodA nucleic acids yielded important information in this study. Although the primers in region 1 and region 4 were capable of detecting nontuberculous mycobacteria, sequence analysis of the amplicons was most consistent with members of MTB complex, thus revealing mycobacteria capable of inducing granuloma formation. The majority of the sequences possessed 100% positional identity with MTB (GenBank No. AF061030); however, sequence analysis of the amplicons also revealed sequences that were genetically distinct (Table 3, Figure 1B). To confirm a polymorphism, we insured that the nucleotide substitution was present on both strands and that an actual peak was visualized on the chromatogram. The detection of the polymorphism, A302G, in two sarcoidosis specimens processed and analyzed at separate time points also suggests that this polymorphism is not due to PCR error.

                    Phylogenetic analysis of the amplicons derived from the sarcoidosis granulomas revealed three major points: 1) There is a clear association between the sarcoidosis amplicons and the sequences of members of MTB complex, demonstrating that they share a recent common ancestor, and precluding the possibility that the sarcoidosis sequences are derived from distantly related mycobacterial or Nocardia species. 2) The sequences from Sarcoidosis 2 and 15 form a distinct clade, emphasizing that these sequences may belong to a single mycobacterial species (Figure 1B). Whether these mutations reflect a distinct member of MTB complex or M. tuberculosis strain with a mutation in sodA is unclear. A sodA mutation, unique from that found in the two sarcoidosis specimens, has been described in an isoniazid-resistant MTB strain [18]. 3) The substantial evolutionary distances between the sarcoidosis amplicons and the atypical mycobacteria eliminate the possibility that we have sequences of environmental mycobacteria as a contaminant.

                    Superinfecting mycobacteria preferentially home to tuberculous granulomas [16]. This observation has been used to explain the detection of mycobacterial nucleic acids in sarcoidosis granulomas. We included in this analysis 10 granulomatous control specimens of known etiology. SodA DNA was detected in only two of them. One of the specimens was a lymph node containing Histoplasma capsulatum in an individual with rheumatoid arthritis. Prior reports have noted an association with latent tuberculosis in such patients [19]. The detection of mycobacterial sodA in sarcoidosis specimens in a significantly different proportion compared to granulomatous negative control specimens suggests that the presence of sodA sequences does not simply reflect preferential localization of environmental mycobacteria to established granulomas.

                    The inclusion of sarcoidosis and control specimens that were frozen or paraffin-embedded was designed to address the possibility that mycobacteria are introduced into sarcoidosis specimens during tissue fixation. There are reports of environmental mycobacteria in hospital water systems, and well as fiberoptic bronchoscopes [20, 21]. We chose snap frozen and paraffin-embedded tissue specimens among the sarcoidosis and PPD- controls specimens. The absence of sodA in the majority of the negative control specimens, as well as the presence of sodA nucleic acids in snap frozen and paraffin-embedded sarcoidosis tissues, suggests that the mycobacterial nucleic acids detected are not present due to contamination during tissue fixation. Identification of immunogenic sodA peptides has not been previously reported in tuberculosis or sarcoidosis subjects. Despite the absence of mycobacteria by histologic staining and culture of sarcoidosis specimens, the immune response to sodA among the sarcoidosis subjects more closely reflected the response among PPD+ subjects than PPD- volunteers. There was not a significant difference between the sarcoidosis and tuberculosis subjects in the percentage of subjects recognizing these peptides or the distribution of the T cell frequencies (Figure 2). Many of the sarcoidosis and PPD+ subjects recognized more than one peptide, suggesting that the immune response observed in these subjects can be elicited by multiple sodA epitopes (Figure 3). Due to limitations in the number of PBMC, we were unable to test all 40 sodA peptides, so it is possible that sodA epitopes other than the four that we tested exist.

                    The dual assessment for mycobacteria in sarcoidosis pathogenesis provides interesting information. Among the 12 subjects, 10 possessed molecular or immunologic evidence for sodA. This illustrates the importance of using complementary approaches to assess for microorganisms in pathologic specimens of unknown etiology. The two sarcoidosis subjects who were negative by both methods suggest that mycobacteria do not have a role in all sarcoidosis specimens, supporting other reports of the inappropriate diagnosis of sarcoidosis in subjects with disease with close phenotypic and pathologic features, such as chronic beryllium disease [22]. Thus sarcoidosis may be a common pathologic phenotype that can be caused by infectious or non-infectious etiologies.

                    PCR of archival specimens was more sensitive for sodA than ELISPOT analysis of peripheral blood (Table 5). There was a time lapse between acquisition of the blood and tissue samples in a given patient; this differential timing of biopsies and blood testing is a major limitation of the analysis. The common observance in the dual analysis was a positive PCR analysis for sodA but a lack of recognition by ELISPOT analysis. This result is likely due to the preservation of nucleic acids by tissue fixation, as opposing to an evolving host immune response. Some of the patients had resolved their disease between the diagnostic biopsy and acquisition of PBMC. Concordantly, there exists evidence that immune recognition of mycobacterial antigens cease with clearance of mycobacteria [17, 23, 24]. Future studies using blood and tissue of sarcoidosis subjects obtained simultaneously will be performed. Another limitation is that the PCR involves analysis of a site of active sarcoidosis involvement [ie the granuloma], whereas the immunologic analysis involves systemic responses. Sensitivity for immune recognition might improve by using lymphocytes from sites of active inflammation such as bronchoalveolar lavage fluid or directly from lymphocytes derived from fresh sarcoidosis granulomas. Finally, the sensitivity of the ELISPOT may have improved if we had tested all 40 sodA peptides. It is unlikely that the four peptides are recognized by all HLA types [25].

                    Conclusion

                    The most interesting finding in this study was the demonstration that molecular analysis of sarcoidosis granulomas for microbial virulence factors can lead to identification of target antigens. The responses detected closely parallel prior reports of immune recognition of secreted proteins in mycobacterial infections [17, 26]. A dual analysis for microbial nucleic acids and immune responses increases the sensitivity for detecting microbial virulence factors in idiopathic diseases, providing complementary mechanisms.

                    Consent

                    This study was approved by the Vanderbilt University Institutional Review Board for human studies, and informed written consent was obtained from the study participant or their surrogates, if required. A copy of the written consent is available for review by the Editor-in-Chief of this journal at any time.

                    Declarations

                    Acknowledgements

                    Support for SSA and WPD is by R01 AI 65744; WE, RH, JEJ, MN, and WPD were funded under R01 HL 83839; JC was funded by the Vanderbilt Medical Scholars Program. The funding bodies have no role in study design; in the collection, analysis, and interpretation of data; in the writing of the manuscript; and in the decision to submit the manuscript for publication.

                    Authors’ Affiliations

                    (1)
                    Department of Medicine, Division of Infectious Diseases, Vanderbilt University School of Medicine
                    (2)
                    Department of Biostatistics, Vanderbilt University School of Medicine
                    (3)
                    Department of Medicine, Division of Infectious Diseases, Stanford School of Medicine
                    (4)
                    Department of Pathology, Vanderbilt University School of Medicine
                    (5)
                    Department of Microbiology and Immunology, Vanderbilt University School of Medicine

                    References

                    1. Baughman RP, Teirstein AS, Judson MA, Rossman MD, Yeager H JR, Brenitz EA, Depalo L, Hunninghake G, Iannuzzi MC, Johns CJ, MCLennan G, Moller DR, Newman LS, Rabin DL, Rose C, Rybicki B, Weinberger SE, Terrin ML, Knatterrud GL, Cherniak R, A Case Control Etiologic Study of Sarcoidosis Group: Clinical characteristics of patients in a case control study of sarcoidosis. Am J Respir Crit Care Med 2001, 164:1885–9.View ArticlePubMed
                    2. Newman LS: Metals that cause sarcoidosis. Semin Respir Infect 1998, 13:212–20.PubMed
                    3. Rose C: Hypersensitivity pneumonitis. In Occupational and environmental respiratory disease. Edited by: Harber P, Schenker M, Balmes J. Mosby Year Book, Inc., St. Louis; 1996:201–215.
                    4. Scadding JG, Mitchell DN: Sarcoidosis. 2nd edition. London: Chapman and Hall; 1985:36–41.View Article
                    5. Drake WP, Pei Z, Pride DT, Collins RD, Cover TL, Blaser MJ: Molecular analysis of sarcoidosis and control tissues for Mycobacteria DNA. Emerg Infect Dis 2002, 8:1328–1335.View Article
                    6. Song Z, Marzilli L, Greenlee BM, Chen ES, Silver RF, Askin FB, Teirstein AS, Zhang Y, Cotter RJ, Moller DR: Mycobacterial catalase-peroxidase is a tissue antigen and target of the adaptive immune response in systemic sarcoidosis. J Experimental Med 2005,201(5):755–67.View Article
                    7. Dubaniewicz A, Kampfer S, Singh M: Serum anti-mycobacterial heat shock proteins antibodies in sarcoidosis and tuberculosis. Tuberculosis 2005, 86:60–67.View ArticlePubMed
                    8. Dubaniewicz A, Dubaniewicz-Wybieralska M, Sternau A, Zwolska Z, Izycka-Swieszewska E, Augustynowicz-Kopec E, Skokowski J, Singh M, Zimnoch L: Mycobacterium tuberculosis Complex and Mycobacterial Heat Shock Proteins in Lymph Node Tissue from Patients with Pulmonary Sarcoidosis. J Clin Microbiol 2006, 44:3448–3451.PubMed CentralView ArticlePubMed
                    9. Drake WP, Dhason MS, Nadaf M, Shepherd BE, Vivedulu S, Hajizadeh R, Newman LS, Kalams SA: Cellular recognition of Mycobacterium ESAT-6 and katG peptides in systemic sarcoidosis. Infect Immun 2007, 75:525–530.View Article
                    10. Harth G, Horwitz MA: Export of recombinant Mycobacterium tuberculosis superoxide dismutase is dependent upon both information in the protein and mycobacterial export machinery. A model for studying export of leaderless proteins by pathogenic mycobacteria. J Biol Chem 1999, 274:4281–4292.View ArticlePubMed
                    11. Zhang Y, Lathigra R, Garbe T, Catty D, Young D: Genetic analysis of superoxide dismutase, the 23 kilodalton antigen of Mycobacterium tuberculosis . Mol Microbiol 1991, 5:381–391.View ArticlePubMed
                    12. Andersen P: The T Cell Response to Secreted Antigens of Mycobacterium tuberculosis . Immunobiol 1994, 191:537–547.View Article
                    13. Zolg JW, Philippi-Schulz S: The Superoxide Dismutase Gene, a Target for detection and identification of mycobacteria by PCR. J Clin Microbiol 1994, 32:2801–12.PubMed CentralPubMed
                    14. Carlisle J, Evans W, Hajizadeh R, Richter K, Drake WP: "Immune recognition of multiple mycobacterial antigens by sarcoidosis subjects.". J Clin Exp Immunol 2007, 150:460–8.View Article
                    15. Altfeld MA, Livingston B, Reshamwala N: Identification of novel HLA-A2-restricted human immunodeficiency virus type 1-specific cytotoxic T-lymphocyte epitopes predicted by the HLA-A2 supertype peptide-binding motif. J Virol 2001, 75:1301–311.PubMed CentralView ArticlePubMed
                    16. Cosma CL, Humbert O, Ramakrishnan L: Superinfecting mycobacteria home to established tuberculous granulomas. Nature Immunol 2004, 5:828–35.View Article
                    17. Pathan AA, Wilkinson KA, Klenerman P, McShane H, Davidson RN, Pasvol G, Hill AV, Lalvani A: Direct ex vivo analysis of antigen-specific IFN-gamma-secreting CD4 T cells in Mycobacterium tuberculosis-infected individuals: associations with clinical disease state and effect of treatment. J Immunol 2001, 167:5217–25.View ArticlePubMed
                    18. Zhang Y, Garcia MJ, Lathigra R, Allen B, Moreno C, A Van Emden JD, Young D: Alterations in the Superoxide Dismutase Gene of an Isoniazid-Resistant Strain of Mycobacterium tuberculosis. Infect Immun 1992, 60:2160–5.PubMed CentralPubMed
                    19. Keane J, Gershon S, Wise RP, Mirabile-Levens E, Kasznica J, Schwieterman WD, Siegel JN, Braun MM: Tuberculosis associated with infliximab, a TNF-á-neutralizing agent. N Engl J Med 2001, 345:1098–1104.View ArticlePubMed
                    20. Arnow PM, Bakir M, Thompson K, Bova JL: Endemic contamination of clinical specimens by Mycobacterium gordonae . Clin Infect Dis 2000, 31:472–6.View ArticlePubMed
                    21. Brown NM, Hellyar EA, Harvey JE, Reeves DS: Mycobacterial contamination of fibreoptic bronchoscopes. Thorax 1993, 48:1283–5.PubMed CentralView ArticlePubMed
                    22. Muller-Quernheim J, Gaede KI, Fireman E, Zissel G: Diagnoses of chronic beryllium disease within cohorts of sarcoidosis patients. Eur Respir J 2006, 27:1190–5.View ArticlePubMed
                    23. Aiken AM, Hill A Fox PC, McAdam KP, Jackson-Sillah D, Lugos MD, Donkor SA, Adegbola RA, Brookes RH: Reversion of the ELISPOT test after treatment in Gambian tuberculosis cases. BMC Infectious Diseases 2006, 6:66.PubMed CentralView ArticlePubMed
                    24. Mazurek GH, Philip LoBue A, Daley CL, Bernardo J, Lardizabal AA, Bishai WR, Iademarco MF, Rothel JS: Comparison of a Whole-Blood Interferon γ Assay With Tuberculin Skin Testing for Detecting Latent Mycobacterium tuberculosis Infection. JAMA 2001, 286:1740–1747.View ArticlePubMed
                    25. Mustafa AS: HLA-restricted immune response to mycobacterial antigens: relevance to vaccine design. Hum Immunol 2000, 61:166–71.View ArticlePubMed
                    26. Ravn P, Munk ME, Andersen AB, Lundgren B, Lundgren JD JD, Nielsen LN, Kok-Jensen A, Andersen P, Weldingh K: Prospective evaluation of a whole-blood test using Mycobacterium tuberculosis-specific antigens ESAT-6 and CFP-10 for diagnosis of active tuberculosis. Clin & Diag Lab Immunol 2005, 12:491–6.

                    Copyright

                    © Allen et al. 2008

                    This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                    Advertisement